MirGeneDB

MirGeneDB ID

Asu-Mir-1175

Family name MIR-1175 (all species)
Seed GAGAUUC
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-1175
Paralogues
Orthologues Aae-Mir-1175  Bge-Mir-1175  Cgi-Mir-1175  Cte-Mir-1175  Dan-Mir-1175  Dme-Mir-1175  Dmo-Mir-1175  Dpu-Mir-1175  Efe-Mir-1175-P1  Efe-Mir-1175-P2  Hme-Mir-1175  Isc-Mir-1175  Lan-Mir-1175  Lgi-Mir-1175  Tca-Mir-1175 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold33: 575559-575621 [+]
Clustered MiRNAs
(< 10kb from Mir-1175)
Mir-750 Scaffold33: 575078-575140 [+]
Mir-1175 Scaffold33: 575559-575621 [+]
Precursor
(pre-Mir +30nt flank)
GCGACGGCCAAUGCAUAUGGACGGUCAAAAAAGUGGAGGAUUGGGUCUGCACUGAAUGACAUGGCAUAGUGAGAUUCUCAUUCCUCCAUUUAGCUGCCUGUUCUUAUUGCUGUCAUAUGGCCA
Get precursor sequence
Structure
        10          20        30        40          50        60
GCGACGGCCAAUGCAUAU--      U  AAA          U    --|  G    GAAUGA 
                    GGACGG CA   AAGUGGAGGA UGGG  UCU CACU      C
                    CUUGUC GU   UUUACCUCCU ACUC  AGA GUGA      A
ACCGGUAUACUGUCGUUAUU      C  CGA          U    UU^  -    UACGGU 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-1175_5p*

MirBase accessionMIMAT0021533
Sequence
0- AAGUGGAGGAUUGGGUCUGCACU -23
Get sequence
Mature sequence

Asu-Mir-1175_3p

MirBase accessionMIMAT0021534
Sequence
39- UGAGAUUCUCAUUCCUCCAUUUAG -63
Get sequence