MirGeneDB

MirGeneDB ID

Dan-Mir-1175

Family name MIR-1175 (all species)
Seed GAGAUUC
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-1175  Asu-Mir-1175  Bge-Mir-1175  Cgi-Mir-1175  Cte-Mir-1175  Dme-Mir-1175  Dmo-Mir-1175  Dpu-Mir-1175  Efe-Mir-1175-P1  Efe-Mir-1175-P2  Hme-Mir-1175  Isc-Mir-1175  Lan-Mir-1175  Lgi-Mir-1175  Tca-Mir-1175 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13337: 22380422-22380484 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAUAUUCCAACGACCGGUGGGUUUUUAGCAAGUAGAAUAGCAGGCUUAUCACAGGUUCCUUUAACCCACUGUGAGAUUCUUCUAUUCUACUUUCGAGAAACACCCGUAAACACCGAUCUCCUG
Get precursor sequence
Structure
        10         20         30        40        50        60 
AAUAUUCCAACGACCGGU-  -|     AGC           C   CUUA     GGUUCCU 
                   GG GUUUUU   AAGUAGAAUAG AGG    UCACA       U
                   CC CAAAGA   UUCAUCUUAUC UCU    AGUGU       U
GUCCUCUAGCCACAAAUGC  A^     GCU           U   UAG-     CACCCAA 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-1175_5p*

MirBase accessionNone
Sequence
0- AGUAGAAUAGCAGGCUUAUCACA -23
Get sequence
Mature sequence

Dan-Mir-1175_3p

MirBase accessionNone
Sequence
41- UGAGAUUCUUCUAUUCUACUUU -63
Get sequence