MirGeneDB

MirGeneDB ID

Lgi-Mir-750

Family name MIR-750 (all species)
Seed CAGAUCU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-750
Paralogues
Orthologues Aae-Mir-750  Asu-Mir-750  Bge-Mir-750  Cgi-Mir-750  Cte-Mir-750  Dpu-Mir-750  Efe-Mir-750-P1  Efe-Mir-750-P2  Efe-Mir-750-P3  Hme-Mir-750  Isc-Mir-750  Lan-Mir-750  Tca-Mir-750 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Lotgi1)
LOTGIsca_236: 113228-113290 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-750)
Mir-750 LOTGIsca_236: 113228-113290 [+] Ensembl
Mir-1175 LOTGIsca_236: 116361-116422 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGGAUUAUGGGUAAUACAUGUUUCAGUUCGUUGGAAGAUUCGACCUUGACAUUGUUCCAUAGAAUUUGUCAGAUCUAACUCUUCCAGCUCAUUGAGAUUUGUUUAAAAACAUCGUUGAUUG
Get precursor sequence
Structure
        10          20        30        40         50        60 
GAAGGAUUAUGGGUAAU--   U        UC         -| C  CC      UUGUUCC 
                   ACA GUUUCAGU  GUUGGAAGA UU GA  UUGACA       \
                   UGU UAGAGUUA  CGACCUUCU AA CU  GACUGU       A
GUUAGUUGCUACAAAAAUU   U        CU         C^ U  A-      UUAAGAU 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Lgi-Mir-750_5p* (predicted)

MirBase accessionNone
Sequence
0- CGUUGGAAGAUUCGACCUUGACA -23
Get sequence
Mature sequence

Lgi-Mir-750_3p

MirBase accessionMIMAT0009600
Sequence
40- UCAGAUCUAACUCUUCCAGCUCA -63
Get sequence