MirGeneDB

MirGeneDB ID

Hme-Mir-750

Family name MIR-750 (all species)
Seed CAGAUCU
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID
Paralogues
Orthologues Aae-Mir-750  Asu-Mir-750  Bge-Mir-750  Cgi-Mir-750  Cte-Mir-750  Dpu-Mir-750  Efe-Mir-750-P1  Efe-Mir-750-P2  Efe-Mir-750-P3  Isc-Mir-750  Lan-Mir-750  Lgi-Mir-750  Tca-Mir-750 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Hmel_1)
HE669540: 33040-33101 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GACGGCACUCAUUGUUAGGCUUCACGUCUGAGUUGGACAGGGGAUCAUGACAGUUUAAAAACACAUGCUGCCAGAUCUAUCUUUCCAGCUCACGCGUGGAACCUCCAACUGCUCGACGGCGU
Get precursor sequence
Structure
        10          20        30        40         50        60
GACGGCACUCAUUGUUA--  C       C         C   -|    A  A  GUUUAAA 
                   GG UUCACGU UGAGUUGGA AGG GGAUC UG CA       A
                   CC AGGUGCG ACUCGACCU UCU UCUAG AC GU       A
UGCGGCAGCUCGUCAACCU  A       C         U   A^    -  C  CGUACAC 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-750_5p*

MirBase accessionNone
Sequence
0- AGUUGGACAGGGGAUCAUGACA -22
Get sequence
Mature sequence

Hme-Mir-750_3p

MirBase accessionNone
Sequence
40- CCAGAUCUAUCUUUCCAGCUCA -62
Get sequence