MirGeneDB

MirGeneDB ID

Cli-Mir-489-v1

Family name MIR-489 (all species)
Seed UGACAUC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-489
Paralogues Cli-Mir-489-v2 
Orthologues Aca-Mir-489-v1  Ami-Mir-489-v1  Bta-Mir-489-v1  Cfa-Mir-489  Cpi-Mir-489-v1  Dno-Mir-489  Dre-Mir-489-v1  Gga-Mir-489-v1  Hsa-Mir-489-v1  Mml-Mir-489-v1  Mmu-Mir-489  Ocu-Mir-489  Rno-Mir-489  Tgu-Mir-489-v1  Xtr-Mir-489-v1 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(colLiv2)
scaffold169: 1811717-1811776 [+]
Clustered MiRNAs
(< 10kb from Mir-489-v1)
Mir-489-v2 scaffold169: 1811716-1811777 [+]
Mir-489-v1 scaffold169: 1811717-1811776 [+]
Precursor
(pre-Mir +30nt flank)
UAACAGUCAUUUGUCACGUGGUGGCUUGGUGGUCGUAUGUAUGACGUCAUUUACUUGGACUUUUAGGAGUGACAUCAUAUGUACGGCUGCUAAACUGCUGCAUGGGACAUCACUUAAACA
Get precursor sequence
Structure
        10          20        30        40        50         
UAACAGUCAUUUGUCAC--|UG UG C    UG             C       ACUUGG 
                   G  G  G UUGG  GUCGUAUGUAUGA GUCAUUU      A
                   C  C  C AAUC  CGGCAUGUAUACU CAGUGAG      C
ACAAAUUCACUACAGGGUA^GU GU A    GU             A       GAUUUU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-489-v1_5p* (predicted)

MirBase accessionMIMAT0038656
Sequence
0- GGUCGUAUGUAUGACGUCAUUU -22
Get sequence
Mature sequence

Cli-Mir-489-v1_3p

MirBase accessionMIMAT0038657
Sequence
38- GUGACAUCAUAUGUACGGCUGC -60
Get sequence