MirGeneDB

MirGeneDB ID

Aca-Mir-489-v1

Family name MIR-489 (all species)
Seed UGACAUC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-489
Paralogues Aca-Mir-489-v2 
Orthologues Ami-Mir-489-v1  Bta-Mir-489-v1  Cfa-Mir-489  Cli-Mir-489-v1  Cpi-Mir-489-v1  Dno-Mir-489  Dre-Mir-489-v1  Gga-Mir-489-v1  Hsa-Mir-489-v1  Mml-Mir-489-v1  Mmu-Mir-489  Ocu-Mir-489  Rno-Mir-489  Tgu-Mir-489-v1  Xtr-Mir-489-v1 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(anoCar2)
6: 21750917-21750976 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-489-v1)
Mir-489-v2 6: 21750916-21750977 [-] UCSC Ensembl
Mir-489-v1 6: 21750917-21750976 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUAACAGUUUUUAAUGCGUGAUGGCUUGGUGGUCGUAUGUAUGACGUCAUUUACUUGUUCUUUUAGGAGUGACAUCAUAUGUACGGCUGCUAAACUGCCACAUGGGACAUCAAUUAAGCA
Get precursor sequence
Structure
        10          20        30        40        50         
AUAACAGUUUUUAAUGC--|  AU  C    UG             C       ACUUGU 
                   GUG  GG UUGG  GUCGUAUGUAUGA GUCAUUU      U
                   CAC  UC AAUC  CGGCAUGUAUACU CAGUGAG      C
ACGAAUUAACUACAGGGUA^  CG  A    GU             A       GAUUUU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-489-v1_5p*

MirBase accessionMIMAT0021974
Sequence
0- GGUCGUAUGUAUGACGUCAUUU -22
Get sequence
Mature sequence

Aca-Mir-489-v1_3p

MirBase accessionMIMAT0021975
Sequence
38- GUGACAUCAUAUGUACGGCUGC -60
Get sequence