MirGeneDB

MirGeneDB ID

Aca-Mir-489-v2

Family name MIR-489 (all species)
Seed GACAUCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-489
Paralogues Aca-Mir-489-v1 
Orthologues Ami-Mir-489-v2  Bta-Mir-489-v2  Cfa-Mir-489  Cli-Mir-489-v2  Cpi-Mir-489-v2  Dno-Mir-489  Dre-Mir-489-v2  Gga-Mir-489-v2  Hsa-Mir-489-v2  Mml-Mir-489-v2  Mmu-Mir-489  Ocu-Mir-489  Rno-Mir-489  Tgu-Mir-489-v2  Xtr-Mir-489-v2 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(anoCar2)
6: 21750916-21750977 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-489-v2)
Mir-489-v2 6: 21750916-21750977 [-] UCSC Ensembl
Mir-489-v1 6: 21750917-21750976 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAUAACAGUUUUUAAUGCGUGAUGGCUUGGUGGUCGUAUGUAUGACGUCAUUUACUUGUUCUUUUAGGAGUGACAUCAUAUGUACGGCUGCUAAACUGCCACAUGGGACAUCAAUUAAGCAA
Get precursor sequence
Structure
        10        20           30        40        50        60
UAUAACAGUUUUUAAUGC   A    ---|   UG             C      UACUUGU 
                  GUG UGGC   UUGG  GUCGUAUGUAUGA GUCAUU       U
                  UAC ACCG   AAUC  CGGCAUGUAUACU CAGUGA       C
AACGAAUUAACUACAGGG   -    UCA^   GU             A      GGAUUUU 
120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-489-v2_5p*

MirBase accessionMIMAT0021974
Sequence
0- UGGUCGUAUGUAUGACGUCAUU -22
Get sequence
Mature sequence

Aca-Mir-489-v2_3p

MirBase accessionMIMAT0021975
Sequence
40- UGACAUCAUAUGUACGGCUGCU -62
Get sequence