MirGeneDB

MirGeneDB ID

Aca-Mir-10-P1c-v2

Family name MIR-10 (all species)
Seed CCCUGUA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-10c
Paralogues Aca-Mir-10-P1a-v1  Aca-Mir-10-P1a-v2  Aca-Mir-10-P1b-v1  Aca-Mir-10-P1b-v2  Aca-Mir-10-P1c-v1  Aca-Mir-10-P2a  Aca-Mir-10-P2b  Aca-Mir-10-P2c  Aca-Mir-10-P3a  Aca-Mir-10-P3b  Aca-Mir-10-P3c 
Orthologues Aae-Mir-10-P1-v1  Aae-Mir-10-P1-v2  Ami-Mir-10-P1c-v1  Ami-Mir-10-P1c-v2  Asu-Mir-10-P1  Bfl-Mir-10-P1-v1  Bfl-Mir-10-P1-v2  Bge-Mir-10-P1-v1  Bge-Mir-10-P1-v2  Cbr-Mir-10-P1  Cel-Mir-10-P1  Cgi-Mir-10-P1  Cli-Mir-10-P1c-v1  Cli-Mir-10-P1c-v2  Cpi-Mir-10-P1c-v1  Cpi-Mir-10-P1c-v2  Cte-Mir-10-P1  Dan-Mir-10-P1  Dme-Mir-10-P1  Dmo-Mir-10-P1  Dpu-Mir-10-P1-v1  Dpu-Mir-10-P1-v2  Dre-Mir-10-P1c-v1  Dre-Mir-10-P1c-v2  Hme-Mir-10-P1-v1  Hme-Mir-10-P1-v2  Isc-Mir-10-P1-v1  Isc-Mir-10-P1-v2  Lgi-Mir-10-P1  Pfl-Mir-10-P1  Pmi-Mir-10-P1  Sko-Mir-10-P1  Spu-Mir-10-P1  Tca-Mir-10-P1-v1  Tca-Mir-10-P1-v2  Xtr-Mir-10-P1c-v1  Xtr-Mir-10-P1c-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(anoCar2)
2: 71991632-71991689 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P1c-v2)
Mir-10-P1c-v1 2: 71991631-71991690 [-] UCSC Ensembl
Mir-10-P1c-v2 2: 71991632-71991689 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAGCCCAAAUUCUCCAGUCGUUUAUAUGUACCCUGUAGAAUCGAAUUUGUGUGAGCACCUCAAUCACAAAUUCGUCUCUAGGGGAGUAUAUGGACGAUGCAGAGCUUUGUUAAAGGU
Get precursor sequence
Structure
        10          20        30        40        50         
ACAGCCCAAAUUCUCCA--|           UA    G    AU          UGAGCA 
                   GUCGUUUAUAUG  CCCU UAGA  CGAAUUUGUG      \
                   UAGCAGGUAUAU  GGGG AUCU  GCUUAAACAC      C
UGGAAAUUGUUUCGAGACG^           GA    -    CU          UAACUC 
      110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-10-P1c-v2_5p

MirBase accessionMIMAT0021721
Sequence
0- ACCCUGUAGAAUCGAAUUUGUG -22
Get sequence
Star sequence

Aca-Mir-10-P1c-v2_3p*

MirBase accessionMIMAT0021722
Sequence
36- ACAAAUUCGUCUCUAGGGGAGU -58
Get sequence