MirGeneDB

MirGeneDB ID

Cgi-Mir-2001

Family name MIR-2001 (all species)
Seed UUGUGAC
Species Pacific oyster (Crassostrea gigas)
MiRBase ID
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(CGI_GCA_000297895.1)
scaffold1366: 96730-96790 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CCUUUUUGUGACAUCGAUAAUCCUUCCUUUUUUGUGACCGUUAUAAUGGGCAUAACGUCUUAUGAAUGCUCGUUGUAUCGAUCAUCAAAAUGGAGGAAUAUGCACGACAGAGCACAAGGUA
Get precursor sequence
Structure
        10        20            30        40        50         
CCUUUUUGUGACAUCGAUAA----|   U  U    U    C  U           UAACGU 
                        UCCU CC UUUU GUGA CG UAUAAUGGGCA      C
                        AGGA GG AAAA UACU GC AUGUUGCUCGU      U
AUGGAACACGAGACAGCACGUAUA^   -  U    C    A  U           AAGUAU 
 .       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
A- D- D- Eg F- Gi He Ju L- Ma Ma Pe Re Sp Um Ea Fe Ha La Ma
Mature sequence

Cgi-Mir-2001_5p

MirBase accessionNone
Sequence
0- UUUGUGACCGUUAUAAUGGGCA -22
Get sequence
Star sequence

Cgi-Mir-2001_3p*

MirBase accessionNone
Sequence
39- UCGUUGUAUCGAUCAUCAAAAU -61
Get sequence