MirGeneDB

MirGeneDB ID

Cte-Mir-2001

Family name MIR-2001 (all species)
Seed UUGUGAC
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-mir-2001
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Capitella_teleta_v1.0)
CAPTEscaffold_296: 188019-188082 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2001)
Mir-2001 CAPTEscaffold_296: 188019-188082 [+] Ensembl
Mir-252-P2 CAPTEscaffold_296: 190705-190762 [+] Ensembl
Mir-252-P1 CAPTEscaffold_296: 191494-191555 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUGAGCUGCUGUGAUAUGCCCGUUCCUCACGUUGUGACCGUUAUAAUGGGCAUGAAGUCAUUCUGAGCAAUGCUCCUUAUAACGAUCUCAAGGCGAUGGGCGCGGCACUGCGACUCUUGGGCGG
Get precursor sequence
Structure
        10         20         30        40        50        60 
GUGAGCUGCUGUGAUAU-   -|    C  ACG   U  C        U     UGAAGUCA 
                  GCC CGUUC UC   UUG GA CGUUAUAA GGGCA        U
                  CGG GCGGG AG   AAC CU GCAAUAUU CUCGU        U
GGCGGGUUCUCAGCGUCA   C^    U  CGG   U  A        C     AACGAGUC 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThis mature read is seedshifted -1 relative to other lophotrochozoans.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cte-Mir-2001_5p

MirBase accessionMIMAT0009705
Sequence
0- GUUGUGACCGUUAUAAUGGGCA -22
Get sequence
Star sequence

Cte-Mir-2001_3p*

MirBase accessionNone
Sequence
42- CUCCUUAUAACGAUCUCAAGGC -64
Get sequence