MirGeneDB

MirGeneDB ID

Sto-Mir-130-P4a

Family name MIR-130 (all species)
Seed AGUGCAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-130-P1b  Sto-Mir-130-P2a  Sto-Mir-130-P2b  Sto-Mir-130-P3a  Sto-Mir-130-P3b  Sto-Mir-130-P4b  Sto-Mir-130-P4o1 
Orthologues Bta-Mir-130-P4a  Cfa-Mir-130-P4a  Cpo-Mir-130-P4a  Dno-Mir-130-P4a  Dre-Mir-130-P4a  Hsa-Mir-130-P4a  Mdo-Mir-130-P4a  Mml-Mir-130-P4a  Oan-Mir-130-P4a  Sha-Mir-130-P4a 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01005977.1: 175036-175100 [+]
Precursor
(pre-Mir +30nt flank)
CAGUUUUUCUUUUGAUGCUCAGGUACUGGGACCCUAUCGAUAUUGCCUCUGCUUUGUAGAUAGCUGUGAGUAGUGCAAUAUUGCUUAUAGGGUUUCAGUGUUUGGGAAUUGCAGCGGCCCGGCUU
Get precursor sequence
Structure
        10          20        30           40        50        60 
CAGUUUUUCUUUUGAUG--    GG     GG       ---|        CU     UUGUAGA 
                   CUCA  UACUG  ACCCUAU   CGAUAUUGC  CUGCU       \
                   GGGU  GUGAC  UGGGAUA   GUUAUAACG  GAUGA       U
UUCGGCCCGGCGACGUUAA    UU     UU       UUC^        U-     GUGUCGA 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-130-P4a_5p*

MirBase accessionNone
Sequence
0- ACCCUAUCGAUAUUGCCUCUGCU -23
Get sequence
Mature sequence

Sto-Mir-130-P4a_3p

MirBase accessionNone
Sequence
40- UAGUGCAAUAUUGCUUAUAGGGUUU -65
Get sequence