MirGeneDB

MirGeneDB ID

Sto-Mir-130-P3b

Family name MIR-130 (all species)
Seed AGUGCAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-130-P1b  Sto-Mir-130-P2a  Sto-Mir-130-P2b  Sto-Mir-130-P3a  Sto-Mir-130-P4a  Sto-Mir-130-P4b  Sto-Mir-130-P4o1 
Orthologues Aca-Mir-130-P3b  Ami-Mir-130-P3b  Cli-Mir-130-P3b  Cpi-Mir-130-P3b  Dre-Mir-130-P3b1  Dre-Mir-130-P3b2  Gga-Mir-130-P3b  Oan-Mir-130-P3b  Tgu-Mir-130-P3b  Xtr-Mir-130-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01012481.1: 61197-61254 [+]
Precursor
(pre-Mir +30nt flank)
UGGCGUUGUUAUUGAAGUCUGUUGACCGGGGCCCUUUUCAUGUUGUACUACUGAGAUUGAGUUAAGCAGUGCAAUAUUAAAAGGGCAUUGGCUGGCAGUAUUCUCCACCUUCCCCACU
Get precursor sequence
Structure
        10          20        30        40        50        
UGGCGUUGUUAUUGAAGU--|    GA    G        C          A  GAGAU 
                    CUGUU  CCGG GCCCUUUU AUGUUGUACU CU     U
                    GACGG  GGUU CGGGAAAA UAUAACGUGA GA     G
UCACCCCUUCCACCUCUUAU^    UC    A        U          C  AUUGA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-130-P3b_5p*

MirBase accessionNone
Sequence
0- GCCCUUUUCAUGUUGUACUACU -22
Get sequence
Mature sequence

Sto-Mir-130-P3b_3p

MirBase accessionNone
Sequence
36- CAGUGCAAUAUUAAAAGGGCAU -58
Get sequence