MirGeneDB

MirGeneDB ID

Sto-Mir-130-P2a

Family name MIR-130 (all species)
Seed AGUGCAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-130-P1b  Sto-Mir-130-P2b  Sto-Mir-130-P3a  Sto-Mir-130-P3b  Sto-Mir-130-P4a  Sto-Mir-130-P4b  Sto-Mir-130-P4o1 
Orthologues Aca-Mir-130-P2a  Ami-Mir-130-P2a  Bta-Mir-130-P2a  Cfa-Mir-130-P2a  Cli-Mir-130-P2a  Cpi-Mir-130-P2a  Cpo-Mir-130-P2a  Dno-Mir-130-P2a  Dre-Mir-130-P2a1  Ete-Mir-130-P2a  Gga-Mir-130-P2a  Hsa-Mir-130-P2a  Mdo-Mir-130-P2a  Mml-Mir-130-P2a  Mmu-Mir-130-P2a  Oan-Mir-130-P2a3  Oan-Mir-130-P2a4  Ocu-Mir-130-P2a  Rno-Mir-130-P2a  Sha-Mir-130-P2a  Tgu-Mir-130-P2a  Xtr-Mir-130-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01005977.1: 164715-164774 [+]
Precursor
(pre-Mir +30nt flank)
UACUUUUUUUCAGGCUUGCUGCUGACGGACGCUCUGACUUUAUUGCACUACUGUGUUUCACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCAUCUGAAGGUAGUUCUGAUCACCCACAGGC
Get precursor sequence
Structure
        10        20        30           40        50         
UACUUUUUUUCAGGCUUG     GA    C   C    U---|         A  GUGUUU 
                  CUGCU  CGGA GCU UGAC    UUAUUGCACU CU      \
                  GAUGG  GUCU CGA ACUG    GAUAACGUGA GA      C
CGGACACCCACUAGUCUU     AA    A   A    UUAU^         C  UCGACA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
To
Star sequence

Sto-Mir-130-P2a_5p*

MirBase accessionNone
Sequence
0- GCUCUGACUUUAUUGCACUACU -22
Get sequence
Mature sequence

Sto-Mir-130-P2a_3p

MirBase accessionNone
Sequence
37- CAGUGCAAUAGUAUUGUCAAAGC -60
Get sequence