MirGeneDB

MirGeneDB ID

Sto-Mir-130-P3a

Family name MIR-130 (all species)
Seed AGUGCAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-130-P1b  Sto-Mir-130-P2a  Sto-Mir-130-P2b  Sto-Mir-130-P3b  Sto-Mir-130-P4a  Sto-Mir-130-P4b  Sto-Mir-130-P4o1 
Orthologues Aca-Mir-130-P3a  Ami-Mir-130-P3a  Cli-Mir-130-P3a  Cpi-Mir-130-P3a  Dre-Mir-130-P3a1  Gga-Mir-130-P3a  Mdo-Mir-130-P3a  Oan-Mir-130-P3a  Sha-Mir-130-P3a  Tgu-Mir-130-P3a  Xtr-Mir-130-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01005977.1: 163281-163343 [+]
Precursor
(pre-Mir +30nt flank)
AACCUGAUGCCGUUUGUCCGUUCGUCCAGUGCCCUUUUUAUGUUGUACUACUAGUGAUAACAGAAAAAAAGCAGUGCAAUAUUAAAAGGGCAUUGGCUGGCGACCAAGCCAAUGUUGCAGAUU
Get precursor sequence
Structure
        10           20        30        40        50        60 
AACCUGAUGCCGUUUGUC---|  UC U             U          A  AGUGAUAA 
                     CGU  G CCAGUGCCCUUUU AUGUUGUACU CU        \
                     GCG  C GGUUACGGGAAAA UAUAACGUGA GA        C
UUAGACGUUGUAACCGAACCA^  GU -             U          C  AAAAAAGA 
 120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-130-P3a_5p*

MirBase accessionNone
Sequence
0- GCCCUUUUUAUGUUGUACUACU -22
Get sequence
Mature sequence

Sto-Mir-130-P3a_3p

MirBase accessionNone
Sequence
41- CAGUGCAAUAUUAAAAGGGCAU -63
Get sequence