MirGeneDB

MirGeneDB ID

Ami-Mir-130-P3a

Family name MIR-130 (all species)
Seed AGUGCAA
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-130c
Paralogues Ami-Mir-130-P1a  Ami-Mir-130-P2a  Ami-Mir-130-P2b  Ami-Mir-130-P3b  Ami-Mir-130-P4b 
Orthologues Aca-Mir-130-P3a  Cli-Mir-130-P3a  Cpi-Mir-130-P3a  Dre-Mir-130-P3a1  Gga-Mir-130-P3a  Mdo-Mir-130-P3a  Oan-Mir-130-P3a  Sha-Mir-130-P3a  Sto-Mir-130-P3a  Tgu-Mir-130-P3a  Xtr-Mir-130-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(allMis1)
JH733892: 180749-180811 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-130-P3a)
Mir-130-P2a JH733892: 180161-180220 [-] UCSC
Mir-130-P3a JH733892: 180749-180811 [-] UCSC
Precursor
(pre-Mir +30nt flank)
UUUAUUCUUGGUGCAUAGUGUCUGUCCAGUGCCCUUUUUAUGUUGUACUACUAGUGAUCGUGCACAAAAAGCAGUGCAAUGUUAAAAGGGCAUUGGCCAGCAAUACUGUCUACAUUACUAGUC
Get precursor sequence
Structure
        10           20        30        40        50        60 
UUUAUUCUUGGUGCAUAG---| U   U             U          A  AGUGAUCG 
                     UG CUG CCAGUGCCCUUUU AUGUUGUACU CU        \
                     AC GAC GGUUACGGGAAAA UGUAACGUGA GA        U
CUGAUCAUUACAUCUGUCAUA^ -   C             U          C  AAAACACG 
 120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Ami-Mir-130-P3a_5p* (predicted)

MirBase accessionNone
Sequence
0- GCCCUUUUUAUGUUGUACUACU -22
Get sequence
Mature sequence

Ami-Mir-130-P3a_3p

MirBase accessionMIMAT0038143
Sequence
41- CAGUGCAAUGUUAAAAGGGCAU -63
Get sequence