MirGeneDB

MirGeneDB ID

Sto-Mir-130-P1b

Family name MIR-130 (all species)
Seed AGUGCAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-130-P2a  Sto-Mir-130-P2b  Sto-Mir-130-P3a  Sto-Mir-130-P3b  Sto-Mir-130-P4a  Sto-Mir-130-P4b  Sto-Mir-130-P4o1 
Orthologues Aca-Mir-130-P1b  Bta-Mir-130-P1b  Cfa-Mir-130-P1b  Cpi-Mir-130-P1b  Cpo-Mir-130-P1b  Dno-Mir-130-P1b  Dre-Mir-130-P1b1  Ete-Mir-130-P1b  Gga-Mir-130-P1b  Hsa-Mir-130-P1b  Mdo-Mir-130-P1b  Mml-Mir-130-P1b  Mmu-Mir-130-P1b  Ocu-Mir-130-P1b  Rno-Mir-130-P1b  Sha-Mir-130-P1b  Tgu-Mir-130-P1b  Xtr-Mir-130-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01012481.1: 69134-69193 [+]
Precursor
(pre-Mir +30nt flank)
CUUGCUGAUGCACAUCCUCAGGCUCCUGCCGCUCUGUCAGUGUUGCGCUACUGUGGACCUGGCGCGAGCAGUGCAAUAUUGAAAGAGCAGCAGUGGCCCGAGCACAGUCGACUAGUACGU
Get precursor sequence
Structure
        10          20        30        40        50         
CUUGCUGAUGCACAUCC--| A   UC    C     G             A  GUGGAC 
                   UC GGC  CUGC GCUCU UCAGUGUUGCGCU CU      C
                   AG CCG  GACG CGAGA AGUUAUAACGUGA GA      U
UGCAUGAUCAGCUGACACG^ C   GU    A     A             C  GCGCGG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Sto-Mir-130-P1b_5p*

MirBase accessionNone
Sequence
0- GCUCUGUCAGUGUUGCGCUACU -22
Get sequence
Mature sequence

Sto-Mir-130-P1b_3p

MirBase accessionNone
Sequence
38- CAGUGCAAUAUUGAAAGAGCAG -60
Get sequence