MirGeneDB

MirGeneDB ID

Dre-Mir-130-P1b1

Family name MIR-130 (all species)
Seed AGUGCAA
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-130b
Paralogues Dre-Mir-130-P2a1  Dre-Mir-130-P2b1  Dre-Mir-130-P2b2  Dre-Mir-130-P3a1  Dre-Mir-130-P3b1  Dre-Mir-130-P3b2  Dre-Mir-130-P4a  Dre-Mir-130-P4b 
Orthologues Aca-Mir-130-P1b  Bta-Mir-130-P1b  Cfa-Mir-130-P1b  Cpi-Mir-130-P1b  Cpo-Mir-130-P1b  Dno-Mir-130-P1b  Ete-Mir-130-P1b  Gga-Mir-130-P1b  Hsa-Mir-130-P1b  Mdo-Mir-130-P1b  Mml-Mir-130-P1b  Mmu-Mir-130-P1b  Ocu-Mir-130-P1b  Rno-Mir-130-P1b  Sha-Mir-130-P1b  Sto-Mir-130-P1b  Tgu-Mir-130-P1b  Xtr-Mir-130-P1b 
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr5: 13299343-13299404 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P1b1)
Mir-130-P2b1 chr5: 13289363-13289425 [+] UCSC Ensembl
Mir-130-P4b chr5: 13296331-13296395 [+] UCSC Ensembl
Mir-130-P1b1 chr5: 13299343-13299404 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUUUUUAUUAUUGAUGUCUGUUGCCUGACACUCUUUCCCUGUUGCACUACUGUGGGAGCUGCAGCAAAGCAGUGCAAUAAUGAAAGGGCAUCAGUCCACUGGACCAGACCAGCAAACACAC
Get precursor sequence
Structure
        10         20         30        40        50        60
UUUUUUUAUUAUUGAUG-   GU  C-|   CA       CC         A  GUGGGAG 
                  UCU  UG  CUGA  CUCUUUC  UGUUGCACU CU       C
                  AGG  AC  GACU  GGGAAAG  AUAACGUGA GA       U
CACACAAACGACCAGACC   UC  CU^   AC       UA         C  AACGACG 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-130-P1b1_5p*

MirBase accessionNone
Sequence
0- ACUCUUUCCCUGUUGCACUACU -22
Get sequence
Mature sequence

Dre-Mir-130-P1b1_3p

MirBase accessionMIMAT0001827
Sequence
40- CAGUGCAAUAAUGAAAGGGCAU -62
Get sequence
Validated targets TargetScanFish: dre-miR-130b