MirGeneDB

MirGeneDB ID

Sto-Mir-130-P2b

Family name MIR-130 (all species)
Seed CUGACGA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-130-P1b  Sto-Mir-130-P2a  Sto-Mir-130-P3a  Sto-Mir-130-P3b  Sto-Mir-130-P4a  Sto-Mir-130-P4b  Sto-Mir-130-P4o1 
Orthologues Aca-Mir-130-P2b  Ami-Mir-130-P2b  Bta-Mir-130-P2b  Cfa-Mir-130-P2b  Cli-Mir-130-P2b  Cpi-Mir-130-P2b  Cpo-Mir-130-P2b  Dno-Mir-130-P2b  Dre-Mir-130-P2b1  Dre-Mir-130-P2b2  Gga-Mir-130-P2b  Hsa-Mir-130-P2b  Mml-Mir-130-P2b  Mmu-Mir-130-P2b  Ocu-Mir-130-P2b  Rno-Mir-130-P2b  Tgu-Mir-130-P2b  Xtr-Mir-130-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01012481.1: 61704-61761 [+]
Precursor
(pre-Mir +30nt flank)
CCUGGGUCAGGGUUGACUGCUGUCGGAGGCUCUGACGAUAUUGCACUACUGUACUCACAGUUAAGCAGUGCAAUAGUAUUGUCAAAGCGUCAGGCACCAGAGAGCGAGCUCCCGUCGA
Get precursor sequence
Structure
        10          20        30        40           50       
CCUGGGUCAGGGUUGAC--  C    G  G   C         ---|     A  GUACUC 
                   UG UGUC GA GCU UGACGAUAU   UGCACU CU      \
                   AC ACGG CU CGA ACUGUUAUG   ACGUGA GA      A
AGCUGCCCUCGAGCGAGAG  C    A  G   A         AUA^     C  AUUGAC 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-130-P2b_5p

MirBase accessionNone
Sequence
0- UCUGACGAUAUUGCACUACU -20
Get sequence
Co-mature sequence

Sto-Mir-130-P2b_3p

MirBase accessionNone
Sequence
35- CAGUGCAAUAGUAUUGUCAAAGC -58
Get sequence