MirGeneDB

MirGeneDB ID

Aca-Mir-130-P2b

Family name MIR-130 (all species)
Seed AGUGCAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-301b
Paralogues Aca-Mir-130-P1a  Aca-Mir-130-P1b  Aca-Mir-130-P2a  Aca-Mir-130-P3a  Aca-Mir-130-P3b  Aca-Mir-130-P4b 
Orthologues Ami-Mir-130-P2b  Bta-Mir-130-P2b  Cfa-Mir-130-P2b  Cli-Mir-130-P2b  Cpi-Mir-130-P2b  Cpo-Mir-130-P2b  Dno-Mir-130-P2b  Dre-Mir-130-P2b1  Dre-Mir-130-P2b2  Gga-Mir-130-P2b  Hsa-Mir-130-P2b  Mml-Mir-130-P2b  Mmu-Mir-130-P2b  Ocu-Mir-130-P2b  Rno-Mir-130-P2b  Sto-Mir-130-P2b  Tgu-Mir-130-P2b  Xtr-Mir-130-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343282.1: 1200203-1200263 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P2b)
Mir-130-P2b GL343282.1: 1200203-1200263 [-] UCSC Ensembl
Mir-130-P3b GL343282.1: 1201646-1201704 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUGCUGCUGGCAGGCUGCUGGGAUUGAUGGCUCUGACAGUGUUGCACUACUGUCUACACAAAUUAAGCAGUGCAAUAAUAUUGUCAAAGCAUUUGGUUCCAGUCCUGAUACAUCCUUGUU
Get precursor sequence
Structure
        10        20        30        40           50         
AAUGCUGCUGGCAGGCUG       UG UG   C         ---|     A  GUCUAC 
                  CUGGGAU  A  GCU UGACAGUGU   UGCACU CU      A
                  GACCUUG  U  CGA ACUGUUAUA   ACGUGA GA      C
UUGUUCCUACAUAGUCCU       GU UA   A         AUA^     C  AUUAAA 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-130-P2b_5p*

MirBase accessionMIMAT0021917
Sequence
0- GCUCUGACAGUGUUGCACUACU -22
Get sequence
Mature sequence

Aca-Mir-130-P2b_3p

MirBase accessionMIMAT0021918
Sequence
38- CAGUGCAAUAAUAUUGUCAAAGC -61
Get sequence