MirGeneDB

MirGeneDB ID

Mmu-Mir-130-P2b

Family name MIR-130 (all species)
Seed AGUGCAA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-301b
Paralogues Mmu-Mir-130-P1a  Mmu-Mir-130-P1b  Mmu-Mir-130-P2a 
Orthologues Aca-Mir-130-P2b  Ami-Mir-130-P2b  Bta-Mir-130-P2b  Cfa-Mir-130-P2b  Cli-Mir-130-P2b  Cpi-Mir-130-P2b  Cpo-Mir-130-P2b  Dno-Mir-130-P2b  Dre-Mir-130-P2b1  Dre-Mir-130-P2b2  Gga-Mir-130-P2b  Hsa-Mir-130-P2b  Mml-Mir-130-P2b  Ocu-Mir-130-P2b  Rno-Mir-130-P2b  Sto-Mir-130-P2b  Tgu-Mir-130-P2b  Xtr-Mir-130-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr16: 17124420-17124477 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P2b)
Mir-130-P1b chr16: 17124071-17124130 [-] UCSC Ensembl
Mir-130-P2b chr16: 17124420-17124477 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGGCGAUGGAUUUCCUGCUGGCUGCGGGUGCUCUGACUAGGUUGCACUACUGUGCUGUGAGAAGCAGUGCAAUGGUAUUGUCAAAGCAUCUGGGACCAGCCUCGAAGACCACCUCAC
Get precursor sequence
Structure
        10        20         30        40           50        
AGGGCGAUGGAUUUCCUG    -  G        C    UAG---|       A  GUGCU 
                  CUGG CU CGGGUGCU UGAC      GUUGCACU CU     \
                  GACC GG GUCUACGA ACUG      UAACGUGA GA     G
CACUCCACCAGAAGCUCC    A  -        A    UUAUGG^       C  AGAGU 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
CommentThe Drosha cut is consistently blunt in all mammals analyzed.
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-130-P2b_5p*

MirBase accessionMIMAT0017232
Sequence
0- GCUCUGACUAGGUUGCACUACU -22
Get sequence
Validated targets TargetScanVert: mmu-miR-301b-5p
miRDB: MIMAT0017232
Mature sequence

Mmu-Mir-130-P2b_3p

MirBase accessionMIMAT0004186
Sequence
35- CAGUGCAAUGGUAUUGUCAAAGC -58
Get sequence
Validated targets microrna.org: MIMAT0004186
TargetScanVert: mmu-miR-301b-3p
miRDB: MIMAT0004186