MirGeneDB

MirGeneDB ID

Cli-Mir-130-P2b

Family name MIR-130 (all species)
Seed AGUGCAA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-301b
Paralogues Cli-Mir-130-P2a  Cli-Mir-130-P3a  Cli-Mir-130-P3b  Cli-Mir-130-P4b 
Orthologues Aca-Mir-130-P2b  Ami-Mir-130-P2b  Bta-Mir-130-P2b  Cfa-Mir-130-P2b  Cpi-Mir-130-P2b  Cpo-Mir-130-P2b  Dno-Mir-130-P2b  Dre-Mir-130-P2b1  Dre-Mir-130-P2b2  Gga-Mir-130-P2b  Hsa-Mir-130-P2b  Mml-Mir-130-P2b  Mmu-Mir-130-P2b  Ocu-Mir-130-P2b  Rno-Mir-130-P2b  Sto-Mir-130-P2b  Tgu-Mir-130-P2b  Xtr-Mir-130-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold1320: 504221-504279 [-]
Clustered MiRNAs
(< 10kb from Mir-130-P2b)
Mir-130-P4b scaffold1320: 497731-497794 [-]
Mir-130-P2b scaffold1320: 504221-504279 [-]
Mir-130-P3b scaffold1320: 505488-505546 [-]
Precursor
(pre-Mir +30nt flank)
AACGUGACAGUGGCUGCUGGUAUCGCUGGCUCUGACAAUGUUGCACUACUGUCUGCACAAAUAAAGCAGUGCAAUAAUAUUGUCAAAGCAUUUGGUUCCAGUCCUAAUACAUCCUUUAU
Get precursor sequence
Structure
        10          20        30        40           50       
AACGUGACAGUGGCUGC--   U    CUG   C         ---|     A  GUCUGC 
                   UGG AUCG   GCU UGACAAUGU   UGCACU CU      A
                   ACC UGGU   CGA ACUGUUAUA   ACGUGA GA      C
UAUUUCCUACAUAAUCCUG   U    UUA   A         AUA^     C  AAUAAA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Cli-Mir-130-P2b_5p*

MirBase accessionMIMAT0038613
Sequence
0- UCUGACAAUGUUGCACUACU -20
Get sequence
Mature sequence

Cli-Mir-130-P2b_3p

MirBase accessionMIMAT0038614
Sequence
36- CAGUGCAAUAAUAUUGUCAAAGC -59
Get sequence