MirGeneDB

MirGeneDB ID

Aca-Mir-130-P2a

Family name MIR-130 (all species)
Seed CUCUGAC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-301a
Paralogues Aca-Mir-130-P1a  Aca-Mir-130-P1b  Aca-Mir-130-P2b  Aca-Mir-130-P3a  Aca-Mir-130-P3b  Aca-Mir-130-P4b 
Orthologues Ami-Mir-130-P2a  Bta-Mir-130-P2a  Cfa-Mir-130-P2a  Cli-Mir-130-P2a  Cpi-Mir-130-P2a  Cpo-Mir-130-P2a  Dno-Mir-130-P2a  Dre-Mir-130-P2a1  Ete-Mir-130-P2a  Gga-Mir-130-P2a  Hsa-Mir-130-P2a  Mdo-Mir-130-P2a  Mml-Mir-130-P2a  Mmu-Mir-130-P2a  Oan-Mir-130-P2a3  Oan-Mir-130-P2a4  Ocu-Mir-130-P2a  Rno-Mir-130-P2a  Sha-Mir-130-P2a  Sto-Mir-130-P2a  Tgu-Mir-130-P2a  Xtr-Mir-130-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343684.1: 336514-336573 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P2a)
Mir-130-P2a GL343684.1: 336514-336573 [-] UCSC Ensembl
Mir-130-P3a GL343684.1: 340820-340882 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGCCAACUUCUUUCCUGCUGCGGACAAGGGCUCUGACUUCAUUGCACUACUGUACUUCCCAACUAGCAGUGCAAUAGUAUUGUCAAAGCACUUGCAAGCAGAACUGACAGCUUGGGUCU
Get precursor sequence
Structure
        10        20        30        40           50         
GUGCCAACUUCUUUCCUG    GGA    G   C    UUC---|       A  GUACUU 
                  CUGC   CAAG GCU UGAC      AUUGCACU CU      \
                  GACG   GUUC CGA ACUG      UAACGUGA GA      C
UCUGGGUUCGACAGUCAA    AAC    A   A    UUAUGA^       C  UCAACC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-130-P2a_5p

MirBase accessionMIMAT0021915
Sequence
0- GCUCUGACUUCAUUGCACUACU -22
Get sequence
Co-mature sequence

Aca-Mir-130-P2a_3p

MirBase accessionMIMAT0021916
Sequence
37- CAGUGCAAUAGUAUUGUCAAAGC -60
Get sequence