MirGeneDB

MirGeneDB ID

Aca-Mir-130-P1a

Family name MIR-130 (all species)
Seed AGUGCAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-130a-1
Paralogues Aca-Mir-130-P1b  Aca-Mir-130-P2a  Aca-Mir-130-P2b  Aca-Mir-130-P3a  Aca-Mir-130-P3b  Aca-Mir-130-P4b 
Orthologues Ami-Mir-130-P1a  Bta-Mir-130-P1a  Cfa-Mir-130-P1a  Cpi-Mir-130-P1a  Cpo-Mir-130-P1a  Dno-Mir-130-P1a  Ete-Mir-130-P1a  Hsa-Mir-130-P1a  Mdo-Mir-130-P1a  Mml-Mir-130-P1a  Mmu-Mir-130-P1a  Oan-Mir-130-P1a  Ocu-Mir-130-P1a  Rno-Mir-130-P1a  Sha-Mir-130-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 91616120-91616181 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAAGUGCACUGUGCAUGGCCCCUGUCCAAGGCUCUUUUCACAUUGUGCUUCUGUCUGUGCCCGACCCAAGCAGUGCAAUGUUAAAAGGGCAUUGGGUGGGUGGCUGCAGCAGCAUGAAGCCU
Get precursor sequence
Structure
        10         20         30        40        50        60
CAAGUGCACUGUGCAUG-   -| UG     G        C      UG  U  GUCUGUG 
                  GCC CC  UCCAA GCUCUUUU ACAUUG  CU CU       C
                  CGG GG  GGGUU CGGGAAAA UGUAAC  GA GA       C
UCCGAAGUACGACGACGU   U^ GU     A        U      GU  C  ACCCAGC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-130-P1a_5p*

MirBase accessionMIMAT0021739
Sequence
0- GCUCUUUUCACAUUGUGCUUCU -22
Get sequence
Mature sequence

Aca-Mir-130-P1a_3p

MirBase accessionMIMAT0021740
Sequence
40- CAGUGCAAUGUUAAAAGGGCAU -62
Get sequence