MirGeneDB

MirGeneDB ID

Rno-Mir-130-P2a

Family name MIR-130 (all species)
Seed AGUGCAA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-301a
Paralogues Rno-Mir-130-P1a  Rno-Mir-130-P1b  Rno-Mir-130-P2b 
Orthologues Aca-Mir-130-P2a  Ami-Mir-130-P2a  Bta-Mir-130-P2a  Cfa-Mir-130-P2a  Cli-Mir-130-P2a  Cpi-Mir-130-P2a  Cpo-Mir-130-P2a  Dno-Mir-130-P2a  Dre-Mir-130-P2a1  Ete-Mir-130-P2a  Gga-Mir-130-P2a  Hsa-Mir-130-P2a  Mdo-Mir-130-P2a  Mml-Mir-130-P2a  Mmu-Mir-130-P2a  Oan-Mir-130-P2a3  Oan-Mir-130-P2a4  Ocu-Mir-130-P2a  Sha-Mir-130-P2a  Sto-Mir-130-P2a  Tgu-Mir-130-P2a  Xtr-Mir-130-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr10: 74417769-74417828 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUCUUUCCUGCUGGCUACUGCUGACGACUGCUCUGACUUUAUUGCACUACUGUACUGUACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCAUCCGGGAGCAGGCUACGCACCUGUCUUGG
Get precursor sequence
Structure
        10        20        30           40        50         
UUUCUUUCCUGCUGGCUA     GA  AC    C    U---|         A  GUACUG 
                  CUGCU  CG  UGCU UGAC    UUAUUGCACU CU      \
                  GACGA  GC  ACGA ACUG    GAUAACGUGA GA      U
GGUUCUGUCCACGCAUCG     GG  CU    A    UUAU^         C  UCGACA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-130-P2a_5p*

MirBase accessionMIMAT0017026
Sequence
0- GCUCUGACUUUAUUGCACUACU -22
Get sequence
Validated targets TargetScanVert: rno-miR-301a-5p
miRDB: MIMAT0017026
Mature sequence

Rno-Mir-130-P2a_3p

MirBase accessionMIMAT0000552
Sequence
37- CAGUGCAAUAGUAUUGUCAAAGC -60
Get sequence
Validated targets microrna.org: MIMAT0000552
TargetScanVert: rno-miR-301a-3p
miRDB: MIMAT0000552