MirGeneDB

MirGeneDB ID

Sto-Mir-124-P4-v2

Family name MIR-124 (all species)
Seed UAAGGCA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-124-P1-v1  Sto-Mir-124-P1-v2  Sto-Mir-124-P2-v1  Sto-Mir-124-P2-v2  Sto-Mir-124-P3-v1  Sto-Mir-124-P3-v2  Sto-Mir-124-P4-v1 
Orthologues Aae-Mir-124  Aca-Mir-124-P4-v1  Aca-Mir-124-P4-v2  Ami-Mir-124-P4-v1  Ami-Mir-124-P4-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cpi-Mir-124-P4-v1  Cpi-Mir-124-P4-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Dre-Mir-124-P4-v1  Dre-Mir-124-P4-v2  Gga-Mir-124-P4-v1  Gga-Mir-124-P4-v2  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Oan-Mir-124-P4-v1  Oan-Mir-124-P4-v2  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01005146.1: 20484-20541 [+]
Precursor
(pre-Mir +30nt flank)
GGAGAAAGGGAGAAUUCGGUUCACACUCUGCGUGUUCACAGCGCACCUUGAUUUCAUAUUAUACAAUUAAGGCACGCGGUGAAUGCCAAGGGAGGAAUCGAAAAUAAGCUAUCUGGGA
Get precursor sequence
Structure
        10          20        30        40        50         
GGAGAAAGGGAGAAUUC--|    ACA UC  C        A   CA        UCAUA 
                   GGUUC   C  UG GUGUUCAC GCG  CCUUGAUU     \
                   CUAAG   G  AC CGUAAGUG CGC  GGAAUUAA     U
AGGGUCUAUCGAAUAAAAG^    GAG GA  -        G   AC        CAUAU 
      110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-124-P4-v2_5p*

MirBase accessionNone
Sequence
0- CGUGUUCACAGCGCACCUUGAUU -23
Get sequence
Mature sequence

Sto-Mir-124-P4-v2_3p

MirBase accessionNone
Sequence
36- UUAAGGCACGCGGUGAAUGCCA -58
Get sequence