MirGeneDB

MirGeneDB ID

Cli-Mir-375

Family name MIR-375 (all species)
Seed UUGUUCG
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-375
Paralogues
Orthologues Aae-Mir-375  Aca-Mir-375  Ami-Mir-375  Asu-Mir-375  Bfl-Mir-375  Bge-Mir-375  Bta-Mir-375  Cbr-Mir-375  Cel-Mir-375  Cfa-Mir-375  Cgi-Mir-375-P3  Cgi-Mir-375-P4  Cin-Mir-375  Cpi-Mir-375  Cpo-Mir-375  Cte-Mir-375  Dan-Mir-375  Dme-Mir-375  Dmo-Mir-375  Dno-Mir-375  Dpu-Mir-375  Dre-Mir-375-P1  Dre-Mir-375-P2  Efe-Mir-375  Ete-Mir-375  Gga-Mir-375  Hme-Mir-375  Hsa-Mir-375  Isc-Mir-375  Lan-Mir-375  Lgi-Mir-375  Mdo-Mir-375  Mml-Mir-375  Mmu-Mir-375  Oan-Mir-375  Ocu-Mir-375  Pfl-Mir-375  Pmi-Mir-375  Rno-Mir-375  Sha-Mir-375  Sko-Mir-375  Spu-Mir-375  Sto-Mir-375  Tca-Mir-375  Tgu-Mir-375  Xtr-Mir-375 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold32: 1406275-1406332 [-]
Precursor
(pre-Mir +30nt flank)
CCGAGCCUGGAGCAACUCUGCACUUGCCUGGCGUCGAGCCCCACGUGCAAGACCUGACCUGAACGUUUUGUUCGUUCGGCUCGCGUUAGGCAGGUCCAGCCCAUCUGCAAGCGUGCGG
Get precursor sequence
Structure
        10          20        30        40        50         
CCGAGCCUGGAGCAACU--|  C            U      CC   U       CUGAC 
                   CUG ACUUGCCUGGCG CGAGCC  ACG GCAAGAC     \
                   GAC UGGACGGAUUGC GCUCGG  UGC UGUUUUG     C
GGCGUGCGAACGUCUACCC^  C            -      CU   U       CAAGU 
      110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-375_5p*

MirBase accessionMIMAT0038628
Sequence
0- GCGUCGAGCCCCACGUGCAAGAC -23
Get sequence
Mature sequence

Cli-Mir-375_3p

MirBase accessionMIMAT0038629
Sequence
36- UUUGUUCGUUCGGCUCGCGUUA -58
Get sequence