MirGeneDB

MirGeneDB ID

Cel-Mir-375

Family name MIR-375 (all species)
Seed UUGUUCG
Species Roundworm (Caenorhabditis elegans)
MiRBase ID cel-mir-356b
Paralogues
Orthologues Aae-Mir-375  Aca-Mir-375  Ami-Mir-375  Asu-Mir-375  Bfl-Mir-375  Bge-Mir-375  Bta-Mir-375  Cbr-Mir-375  Cfa-Mir-375  Cgi-Mir-375-P3  Cgi-Mir-375-P4  Cin-Mir-375  Cli-Mir-375  Cpi-Mir-375  Cpo-Mir-375  Cte-Mir-375  Dan-Mir-375  Dme-Mir-375  Dmo-Mir-375  Dno-Mir-375  Dpu-Mir-375  Dre-Mir-375-P1  Dre-Mir-375-P2  Efe-Mir-375  Ete-Mir-375  Gga-Mir-375  Hme-Mir-375  Hsa-Mir-375  Isc-Mir-375  Lan-Mir-375  Lgi-Mir-375  Mdo-Mir-375  Mml-Mir-375  Mmu-Mir-375  Oan-Mir-375  Ocu-Mir-375  Pfl-Mir-375  Pmi-Mir-375  Rno-Mir-375  Sha-Mir-375  Sko-Mir-375  Spu-Mir-375  Sto-Mir-375  Tca-Mir-375  Tgu-Mir-375  Xtr-Mir-375 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ce11)
chrIII: 7860167-7860234 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUAAUGUGUUCUGAAAUCCUACUAACGAUGUGGUGAGACACGUCGUAACGAAUCCGCUGAAAUUUACAUUGAUGAUUUGUUCGCGUUGCUCAACCACAUUGUUCUCAAGGAAACUUUAACUGUUUAUU
Get precursor sequence
Structure
        10         20         30         40        50        60    
UUAAUGUGUUCUGAAAU-   ACU-          -|   AC   U  U        CGCUGAAAU 
                  CCU    AACGAUGUGG UGAG  ACG CG AACGAAUC         \
                  GGA    UUGUUACACC ACUC  UGC GC UUGUUUAG         U
UUAUUUGUCAAUUUCAAA   ACUC          A^   GU   -  -        UAGUUACAU 
      120       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Wt Da Ea Mi Yo Yo
Star sequence

Cel-Mir-375_5p*

MirBase accessionMIMAT0022311
Sequence
0- UGGUGAGACACGUCGUAACGAAUC -24
Get sequence
Mature sequence

Cel-Mir-375_3p

MirBase accessionMIMAT0022312
Sequence
45- UUUGUUCGCGUUGCUCAACCACA -68
Get sequence