MirGeneDB

MirGeneDB ID

Bta-Mir-375

Family name MIR-375 (all species)
Seed UUGUUCG
Species Cow (Bos taurus)
MiRBase ID bta-mir-375
Paralogues
Orthologues Aae-Mir-375  Aca-Mir-375  Ami-Mir-375  Asu-Mir-375  Bfl-Mir-375  Bge-Mir-375  Cbr-Mir-375  Cel-Mir-375  Cfa-Mir-375  Cgi-Mir-375-P3  Cgi-Mir-375-P4  Cin-Mir-375  Cli-Mir-375  Cpi-Mir-375  Cpo-Mir-375  Cte-Mir-375  Dan-Mir-375  Dme-Mir-375  Dmo-Mir-375  Dno-Mir-375  Dpu-Mir-375  Dre-Mir-375-P1  Dre-Mir-375-P2  Efe-Mir-375  Ete-Mir-375  Gga-Mir-375  Hme-Mir-375  Hsa-Mir-375  Isc-Mir-375  Lan-Mir-375  Lgi-Mir-375  Mdo-Mir-375  Mml-Mir-375  Mmu-Mir-375  Oan-Mir-375  Ocu-Mir-375  Pfl-Mir-375  Pmi-Mir-375  Rno-Mir-375  Sha-Mir-375  Sko-Mir-375  Spu-Mir-375  Sto-Mir-375  Tca-Mir-375  Tgu-Mir-375  Xtr-Mir-375 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr2: 107667524-107667580 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCAGGCCCCGGACCCGCCGCUCCCGCCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGCUCGCGUGAGGCAGGGGCGGCCUCUCAGCACCCGCCCGG
Get precursor sequence
Structure
        10          20        30        40        50        
GCCAGGCCCCGGACCCG--|      C   C    A      CCU  C     C GGAC 
                   CCGCUCC GCC CGCG CGAGCC   CG ACAAA C    C
                   GGCGGGG CGG GUGC GCUCGG   GC UGUUU G    U
GGCCCGCCCACGACUCUCC^      A   A    -      CUU  U     U CGAG 
     110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-375_5p*

MirBase accessionNone
Sequence
0- GCGACGAGCCCCUCGCACAAACC -23
Get sequence
Mature sequence

Bta-Mir-375_3p

MirBase accessionMIMAT0009303
Sequence
35- UUUGUUCGUUCGGCUCGCGUGA -57
Get sequence
Validated targets TargetScanVert: bta-miR-375