MirGeneDB

MirGeneDB ID

Spu-Mir-375

Family name MIR-375 (all species)
Seed UUGUUCG
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-375
Paralogues
Orthologues Aae-Mir-375  Aca-Mir-375  Ami-Mir-375  Asu-Mir-375  Bfl-Mir-375  Bge-Mir-375  Bta-Mir-375  Cbr-Mir-375  Cel-Mir-375  Cfa-Mir-375  Cgi-Mir-375-P3  Cgi-Mir-375-P4  Cin-Mir-375  Cli-Mir-375  Cpi-Mir-375  Cpo-Mir-375  Cte-Mir-375  Dan-Mir-375  Dme-Mir-375  Dmo-Mir-375  Dno-Mir-375  Dpu-Mir-375  Dre-Mir-375-P1  Dre-Mir-375-P2  Efe-Mir-375  Ete-Mir-375  Gga-Mir-375  Hme-Mir-375  Hsa-Mir-375  Isc-Mir-375  Lan-Mir-375  Lgi-Mir-375  Mdo-Mir-375  Mml-Mir-375  Mmu-Mir-375  Oan-Mir-375  Ocu-Mir-375  Pfl-Mir-375  Pmi-Mir-375  Rno-Mir-375  Sha-Mir-375  Sko-Mir-375  Sto-Mir-375  Tca-Mir-375  Tgu-Mir-375  Xtr-Mir-375 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold1492: 109248-109332 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGCUUCCUGGUUAUCACGUGACGCAGUUUGGCACGAGCUCAACGUGCAAAACUUGAGAUAAGGUCAGCUGUUCGGCUGGCCGCUACAUGCUGUUUUGUUCGUUCGGCUCGCGUCAAAUUGCAGUCACACUAUCACCAACAACAAC
Get precursor sequence
Structure
        10         20         30        40        50        60        70  
CGCUUCCUGGUUAUCAC-     -|         A      C    U       UUGAGAUAAGGUCAGCUGU 
                  GUGAC GCAGUUUGGC CGAGCU AACG GCAAAAC                   \
                  CACUG CGUUAAACUG GCUCGG UUGC UGUUUUG                   U
CAACAACAACCACUAUCA     A^         C      C    U       UCGUACAUCGCCGGUCGGC 
   140       130       120       110       100        90        80
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-375_5p* (predicted)

MirBase accessionNone
Sequence
0- GCACGAGCUCAACGUGCAAAAC -22
Get sequence
Mature sequence

Spu-Mir-375_3p

MirBase accessionMIMAT0009648
Sequence
63- UUUGUUCGUUCGGCUCGCGUCA -85
Get sequence