MirGeneDB

MirGeneDB ID

Dan-Mir-375

Family name MIR-375 (all species)
Seed UUGUUCG
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-375  Aca-Mir-375  Ami-Mir-375  Asu-Mir-375  Bfl-Mir-375  Bge-Mir-375  Bta-Mir-375  Cbr-Mir-375  Cel-Mir-375  Cfa-Mir-375  Cgi-Mir-375-P3  Cgi-Mir-375-P4  Cin-Mir-375  Cli-Mir-375  Cpi-Mir-375  Cpo-Mir-375  Cte-Mir-375  Dme-Mir-375  Dmo-Mir-375  Dno-Mir-375  Dpu-Mir-375  Dre-Mir-375-P1  Dre-Mir-375-P2  Efe-Mir-375  Ete-Mir-375  Gga-Mir-375  Hme-Mir-375  Hsa-Mir-375  Isc-Mir-375  Lan-Mir-375  Lgi-Mir-375  Mdo-Mir-375  Mml-Mir-375  Mmu-Mir-375  Oan-Mir-375  Ocu-Mir-375  Pfl-Mir-375  Pmi-Mir-375  Rno-Mir-375  Sha-Mir-375  Sko-Mir-375  Spu-Mir-375  Sto-Mir-375  Tca-Mir-375  Tgu-Mir-375  Xtr-Mir-375 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_12916: 2747027-2747091 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACACCCCACGGAAACGAGGGGCAGCGAAUUACUUGGGCCAAGGGAAUUCAAACUGUGAUCGCAAUGCUAGAAGUUUGUUCGUUUGGCUUAAGUUAUUUUCAUGUCCGUUGCAAACGCCACGUGGU
Get precursor sequence
Structure
        10         20         30        40        50        60   
ACACCCCACGGAAACGAG-     GC-|   U            G   UU      GUGAUCGC 
                   GGGCA   GAAU ACUUGGGCCAAG GAA  CAAACU        \
                   CCUGU   UUUA UGAAUUCGGUUU CUU  GUUUGA        A
UGGUGCACCGCAAACGUUG     ACU^   U            G   --      AGAUCGUA 
   120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Da
Star sequence

Dan-Mir-375_5p*

MirBase accessionNone
Sequence
0- ACUUGGGCCAAGGGAAUUCAAACU -24
Get sequence
Mature sequence

Dan-Mir-375_3p

MirBase accessionNone
Sequence
43- UUUGUUCGUUUGGCUUAAGUUA -65
Get sequence