MirGeneDB

MirGeneDB ID

Oan-Mir-124-P4-v2

Family name MIR-124 (all species)
Seed UUAAGGC
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-124a-1
Paralogues Oan-Mir-124-P2-v1  Oan-Mir-124-P2-v2  Oan-Mir-124-P3-v1  Oan-Mir-124-P3-v2  Oan-Mir-124-P4-v1 
Orthologues Aae-Mir-124  Aca-Mir-124-P4-v1  Aca-Mir-124-P4-v2  Ami-Mir-124-P4-v1  Ami-Mir-124-P4-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cpi-Mir-124-P4-v1  Cpi-Mir-124-P4-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Dre-Mir-124-P4-v1  Dre-Mir-124-P4-v2  Gga-Mir-124-P4-v1  Gga-Mir-124-P4-v2  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P4-v1  Sto-Mir-124-P4-v2  Tca-Mir-124 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041750.1: 608841-608900 [-]
Clustered MiRNAs
(< 10kb from Mir-124-P4-v2)
Mir-124-P4-v1 NC_041750.1: 608840-608900 [-]
Mir-124-P4-v2 NC_041750.1: 608841-608900 [-]
Precursor
(pre-Mir +30nt flank)
CCCACCCCACCCACACUAGGCCUGUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUUUGUACACAAUUAAGGCACGCGGUGAAUGCCAAGAGCCCAGCCAAAGAACGGCAGCGCCAGC
Get precursor sequence
Structure
        10         20         30        40        50          
CCCACCCCACCCACACUA-|  C  U-    CC        A   GA        UAAAUU 
                   GGC UG  CUCU  GUGUUCAC GCG  CCUUGAUU      \
                   CCG AC  GAGA  CGUAAGUG CGC  GGAAUUAA      U
CGACCGCGACGGCAAGAAA^  -  CC    AC        G   AC        CACAUG 
.       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Oan-Mir-124-P4-v2_5p*

MirBase accessionMIMAT0007113
Sequence
0- CGUGUUCACAGCGGACCUUGAUU -23
Get sequence
Mature sequence

Oan-Mir-124-P4-v2_3p

MirBase accessionMIMAT0007114
Sequence
37- AUUAAGGCACGCGGUGAAUGCCA -60
Get sequence