MirGeneDB

MirGeneDB ID

Isc-Mir-278

Family name MIR-278 (all species)
Seed CGGAUGA
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-278
Paralogues
Orthologues Aae-Mir-278  Bfl-Mir-278  Bge-Mir-278  Cgi-Mir-278  Cte-Mir-278  Dan-Mir-278  Dme-Mir-278  Dmo-Mir-278  Dpu-Mir-278  Efe-Mir-278-P1-v1  Efe-Mir-278-P1-v2  Efe-Mir-278-P2  Hme-Mir-278  Lan-Mir-278  Lgi-Mir-278  Pfl-Mir-278  Pmi-Mir-278  Sko-Mir-278  Spu-Mir-278 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS841188: 7213-7279 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UAGGCUUCUGCAUUAUAGGCUCUGAUGUGUCCGGAUGAAUUUCUCGCCUGGCCGUUUCCGGUCCCCCGGAACAGGUCGGUGGGAUUUUCGUCCGUUUACGUCAGGCCUACAACAACAGUUAGCAGAC
Get precursor sequence
Structure
        10           20        30        40        50        60   
UAGGCUUCUGCAUUAUA---|  U        UC        UU       U    GUUUCCGGU 
                    GGC CUGAUGUG  CGGAUGAA  UCUCGCC GGCC         C
                    CCG GACUGCAU  GCCUGCUU  AGGGUGG CUGG         C
CAGACGAUUGACAACAACAU^  -        UU        UU       -    ACAAGGCCC 
     120       110        100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-278_5p

MirBase accessionNone
Sequence
0- CCGGAUGAAUUUCUCGCCUGGCC -23
Get sequence
Star sequence

Isc-Mir-278_3p*

MirBase accessionMIMAT0016930
Sequence
45- UCGGUGGGAUUUUCGUCCGUUU -67
Get sequence