MirGeneDB

MirGeneDB ID

Spu-Mir-278

Family name MIR-278 (all species)
Seed CGGUGGG
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-278
Paralogues
Orthologues Aae-Mir-278  Bfl-Mir-278  Bge-Mir-278  Cgi-Mir-278  Cte-Mir-278  Dan-Mir-278  Dme-Mir-278  Dmo-Mir-278  Dpu-Mir-278  Efe-Mir-278-P1-v1  Efe-Mir-278-P1-v2  Efe-Mir-278-P2  Hme-Mir-278  Isc-Mir-278  Lan-Mir-278  Lgi-Mir-278  Pfl-Mir-278  Pmi-Mir-278  Sko-Mir-278 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold867: 171662-171726 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACUUCACUUUAAUCAAACUGCCUCUUCUCCUGGAAUGAAAGCCUCGCCAAUCUGUCAUUGUUACUAAGCUAGGUCGGUGGGACUUUCGUUCGAUUAGAAGAUGGUAGAUACUAACUUCUAUUGAG
Get precursor sequence
Structure
        10         20         30        40        50        60  
ACUUCACUUUAAUCAAA-     -|     CCUG         C      A   UGUCAUUGU 
                  CUGCC UCUUCU    GAAUGAAAG CUCGCC AUC         \
                  GAUGG AGAAGA    CUUGCUUUC GGGUGG UGG         U
GAGUUAUCUUCAAUCAUA     U^     UUAG         A      C   AUCGAAUCA 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-278_5p*

MirBase accessionMIMAT0019163
Sequence
0- UGGAAUGAAAGCCUCGCCAAUC -22
Get sequence
Mature sequence

Spu-Mir-278_3p

MirBase accessionMIMAT0009674
Sequence
43- UCGGUGGGACUUUCGUUCGAUU -65
Get sequence