| MirGeneDB ID | Bla-Mir-217 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-217 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | European lancelet (Branchiostoma lanceolatum) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-217-v1 Ami-Mir-217-v1 Bfl-Mir-217 Bta-Mir-217-v1 Cfa-Mir-217-v1 Cja-Mir-217-v1 Cli-Mir-217-v1 Cmi-Mir-217 Cpi-Mir-217-v1 Cpo-Mir-217-v1 Dno-Mir-217-v1 Dre-Mir-217-v1 Ebu-Mir-217-P1-v1 Ebu-Mir-217-P2-v1 Eca-Mir-217-v1 Ete-Mir-217-v1 Gga-Mir-217-v1 Gja-Mir-217-v1 Gmo-Mir-217 Hsa-Mir-217-v1 Laf-Mir-217 Lch-Mir-217 Loc-Mir-217 Mal-Mir-217 Mdo-Mir-217 Mml-Mir-217-v1 Mmr-Mir-217 Mmu-Mir-217-v1 Mun-Mir-217-v1 Neu-Mir-217-v1 Oan-Mir-217-v1 Ocu-Mir-217-v1 Pab-Mir-217-v1 Pbv-Mir-217-v1 Pma-Mir-217-P1 Pma-Mir-217-P2-v1 Rno-Mir-217-v1 Sha-Mir-217-v1 Spt-Mir-217 Sto-Mir-217-v1 Tgu-Mir-217-v1 Tni-Mir-217 Xla-Mir-217-P3-v1 Xla-Mir-217-P4-v1 Xtr-Mir-217-v1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Chordata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Chordata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (BraLan2) |
Sc0000230: 138105-138161 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-217) |
Mir-216-P2
Sc0000230: 137127-137187 [+]
Ensembl
Mir-217 Sc0000230: 138105-138161 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAUCUGU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GCUAUAUCUGCUCUUAUGAGGCACUGGGACUACUGCAUCAGGAACUGAUUGGAUGGGAUACAAAUCAAUCUGUUCCUCAUGCAUGGCUCACAGUGCUGUCUUGUACAGCCUAUUUAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GCUAUAUCUGCUCUUAUGA- -|GA C C U AUGGG GGCACUG G CUA UGCAU AGGAAC GAUUGG A UCGUGAC C GGU ACGUA UCCUUG CUAACU U GAUUUAUCCGACAUGUUCUG A^UC - C U AAACA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Although the highest 3p reads has a templated 3' most uridine this gives the Drosha cut a 3-nt offset suggesting that the 3p arm might be monouridylated. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Bla-Mir-217_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UACUGCAUCAGGAACUGAUUGGA -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Bla-Mir-217_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- CAAUCUGUUCCUCAUGCAUGGC -57
Get sequence
|
