MirGeneDB

MirGeneDB ID

Aca-Mir-217-v1

Family name MIR-217 (all species)
Seed ACUGCAU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-217
Paralogues Aca-Mir-217-v2 
Orthologues Ami-Mir-217-v1  Bfl-Mir-217  Bta-Mir-217-v1  Cfa-Mir-217-v1  Cli-Mir-217-v1  Cpi-Mir-217-v1  Cpo-Mir-217-v1  Dno-Mir-217-v1  Dre-Mir-217-v1  Ete-Mir-217-v1  Gga-Mir-217-v1  Hsa-Mir-217-v1  Mdo-Mir-217  Mml-Mir-217-v1  Mmu-Mir-217-v1  Oan-Mir-217-v1  Ocu-Mir-217-v1  Rno-Mir-217-v1  Sha-Mir-217-v1  Sto-Mir-217-v1  Tgu-Mir-217-v1  Xtr-Mir-217-v1 
Node of Origin (locus) Chordata
Node of Origin (family) Chordata
Genome context
(anoCar2)
1: 256233880-256233938 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-217-v1)
Mir-217-v2 1: 256233879-256233939 [-] UCSC Ensembl
Mir-217-v1 1: 256233880-256233938 [-] UCSC Ensembl
Mir-216-P1a 1: 256236305-256236366 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUAGCCUUCAGAGCUUUUGAUGUCGCAGAUACUGCAUCAGGAACUGAUUGGGGAAUAAUCAUGUACCAUCAGUUCCUAAUGCAUUGCCUUCAGCAUCUAAACAAACAUCAAUUAUGUU
Get precursor sequence
Structure
        10          20        30        40        50         
UGUAGCCUUCAGAGCUUUU--|    CGC  A  C     C          U  GGAAUA 
                     GAUGU   AG UA UGCAU AGGAACUGAU GG      A
                     CUACG   UC GU ACGUA UCCUUGACUA CC      U
UUGUAUUAACUACAAACAAAU^    ACU  C  U     A          -  AUGUAC 
       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-217-v1_5p

MirBase accessionMIMAT0021878
Sequence
0- UACUGCAUCAGGAACUGAUUGGG -23
Get sequence
Star sequence

Aca-Mir-217-v1_3p*

MirBase accessionMIMAT0021879
Sequence
37- CAUCAGUUCCUAAUGCAUUGCC -59
Get sequence