MirGeneDB

MirGeneDB ID

Cli-Mir-217-v1

Family name MIR-217 (all species)
Seed ACUGCAU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-217
Paralogues Cli-Mir-217-v2 
Orthologues Aca-Mir-217-v1  Ami-Mir-217-v1  Bfl-Mir-217  Bta-Mir-217-v1  Cfa-Mir-217-v1  Cpi-Mir-217-v1  Cpo-Mir-217-v1  Dno-Mir-217-v1  Dre-Mir-217-v1  Ete-Mir-217-v1  Gga-Mir-217-v1  Hsa-Mir-217-v1  Mdo-Mir-217  Mml-Mir-217-v1  Mmu-Mir-217-v1  Oan-Mir-217-v1  Ocu-Mir-217-v1  Rno-Mir-217-v1  Sha-Mir-217-v1  Sto-Mir-217-v1  Tgu-Mir-217-v1  Xtr-Mir-217-v1 
Node of Origin (locus) Chordata
Node of Origin (family) Chordata
Genome context
(colLiv2)
scaffold628: 133577-133635 [+]
Clustered MiRNAs
(< 10kb from Mir-217-v1)
Mir-216-P1b scaffold628: 125966-126027 [+]
Mir-216-P1a scaffold628: 130781-130841 [+]
Mir-217-v2 scaffold628: 133576-133636 [+]
Mir-217-v1 scaffold628: 133577-133635 [+]
Precursor
(pre-Mir +30nt flank)
AAGCCAUUGCAGAGUUUUUGAUGUCGCAGAUACUGCAUCAGGAACUGAUUGGAUAAUAAUCAGUCACCAUCAGUUCCUAAUGCAUUGCCUUCAGCAUCUAAACAAGCAUCUAUGAGUUU
Get precursor sequence
Structure
        10          20        30        40        50         
AAGCCAUUGCAGAGUUUUU--|    CGC  A  C     C          U  AUAAUA 
                     GAUGU   AG UA UGCAU AGGAACUGAU GG      A
                     CUACG   UC GU ACGUA UCCUUGACUA CC      U
UUUGAGUAUCUACGAACAAAU^    ACU  C  U     A          -  ACUGAC 
       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-217-v1_5p

MirBase accessionMIMAT0038600
Sequence
0- UACUGCAUCAGGAACUGAUUGGA -23
Get sequence
Star sequence

Cli-Mir-217-v1_3p*

MirBase accessionMIMAT0038601
Sequence
37- CAUCAGUUCCUAAUGCAUUGCC -59
Get sequence