MirGeneDB

MirGeneDB ID

Aca-Mir-124-P4-v2

Family name MIR-124 (all species)
Seed UAAGGCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-124a-3
Paralogues Aca-Mir-124-P1-v1  Aca-Mir-124-P1-v2  Aca-Mir-124-P2-v1  Aca-Mir-124-P2-v2  Aca-Mir-124-P3-v1  Aca-Mir-124-P3-v2  Aca-Mir-124-P4-v1 
Orthologues Aae-Mir-124  Ami-Mir-124-P4-v1  Ami-Mir-124-P4-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cpi-Mir-124-P4-v1  Cpi-Mir-124-P4-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Dre-Mir-124-P4-v1  Dre-Mir-124-P4-v2  Gga-Mir-124-P4-v1  Gga-Mir-124-P4-v2  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Oan-Mir-124-P4-v1  Oan-Mir-124-P4-v2  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P4-v1  Sto-Mir-124-P4-v2  Tca-Mir-124 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL344007.1: 104545-104603 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-124-P4-v2)
Mir-124-P4-v1 GL344007.1: 104544-104603 [-] UCSC Ensembl
Mir-124-P4-v2 GL344007.1: 104545-104603 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUCCUUCCUCCCCCCAGGGCUUGGCCCUUCGUGUUCACAGUGGACCUUGAUUUCAUGUGGACACAAUUAAGGCACGCGGUGAAUGCCAAGAGCCCAGCCCCUGCCCUCCGGACGCCGG
Get precursor sequence
Structure
        10         20        30        40        50         
CCUCCUUCCUCCCCCCA-|    U   C   C        A   GA        UCAUG 
                  GGGCU GGC CUU GUGUUCAC GUG  CCUUGAUU     U
                  CCCGA CCG GAA CGUAAGUG CGC  GGAAUUAA     G
GGCCGCAGGCCUCCCGUC^    C   A   C        G   AC        CACAG 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-124-P4-v2_5p*

MirBase accessionNone
Sequence
0- CGUGUUCACAGUGGACCUUGAUU -23
Get sequence
Mature sequence

Aca-Mir-124-P4-v2_3p

MirBase accessionMIMAT0021725
Sequence
37- UUAAGGCACGCGGUGAAUGCCA -59
Get sequence