MirGeneDB

MirGeneDB ID

Sto-Mir-204-P1

Family name MIR-204 (all species)
Seed UCCCUUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-204-P2  Sto-Mir-204-P3 
Orthologues Aca-Mir-204-P1  Ami-Mir-204-P1  Bta-Mir-204-P1  Cfa-Mir-204-P1  Cli-Mir-204-P1  Cpi-Mir-204-P1  Cpo-Mir-204-P1  Dno-Mir-204-P1  Dre-Mir-204-P1  Ete-Mir-204-P1  Gga-Mir-204-P1  Hsa-Mir-204-P1  Mdo-Mir-204-P1  Mml-Mir-204-P1  Mmu-Mir-204-P1  Oan-Mir-204-P1  Ocu-Mir-204-P1  Rno-Mir-204-P1  Sha-Mir-204-P1  Tgu-Mir-204-P1  Xtr-Mir-204-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000604.1: 438648-438706 [-]
Precursor
(pre-Mir +30nt flank)
UGUAGCCGUUAACCCAUGUGACUUGUGGGCUUCCCUUUGUCAUCCUAUGCCUGGGAAUAUAUGAAGGGGCUGGGAAUGCAAAGGGAUGUUCAACAGUUACCAGCGGCAUCCUAUUGACC
Get precursor sequence
Structure
        10          20        30        40        50         
UGUAGCCGUUAACCCAU--|     UG     U         CA     U    GGGAAU 
                   GUGACU  UGGGC UCCCUUUGU  UCCUA GCCU      A
                   CAUUGA  ACUUG AGGGAAACG  AGGGU CGGG      U
CCAGUUAUCCUACGGCGAC^     CA     U         UA     -    GAAGUA 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-204-P1_5p

MirBase accessionNone
Sequence
0- UUCCCUUUGUCAUCCUAUGCCU -22
Get sequence
Star sequence

Sto-Mir-204-P1_3p*

MirBase accessionNone
Sequence
38- GCUGGGAAUGCAAAGGGAUGU -59
Get sequence