MirGeneDB

MirGeneDB ID

Aca-Mir-204-P1

Family name MIR-204 (all species)
Seed UCCCUUU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-204a-2
Paralogues Aca-Mir-204-P2 
Orthologues Ami-Mir-204-P1  Bta-Mir-204-P1  Cfa-Mir-204-P1  Cli-Mir-204-P1  Cpi-Mir-204-P1  Cpo-Mir-204-P1  Dno-Mir-204-P1  Dre-Mir-204-P1  Ete-Mir-204-P1  Gga-Mir-204-P1  Hsa-Mir-204-P1  Mdo-Mir-204-P1  Mml-Mir-204-P1  Mmu-Mir-204-P1  Oan-Mir-204-P1  Ocu-Mir-204-P1  Rno-Mir-204-P1  Sha-Mir-204-P1  Sto-Mir-204-P1  Tgu-Mir-204-P1  Xtr-Mir-204-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
2: 48871989-48872048 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGCAGUACCUAUUCAUGUGACCCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGGGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCAUCAGCAUCUUCUCUGAU
Get precursor sequence
Structure
        10          20        30        40        50          
CUGCAGUACCUAUUCAU--|    CCG     U          A     U    GAGAAUA 
                   GUGAC   UGGAC UCCCUUUGUC UCCUA GCCU       \
                   UACUG   ACUUG AGGGAAACGG AGGGU CGGG       U
UAGUCUCUUCUACGACUAC^    UUA     C          A     -    GGAAGUA 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-204-P1_5p

MirBase accessionMIMAT0021853
Sequence
0- UUCCCUUUGUCAUCCUAUGCCU -22
Get sequence
Star sequence

Aca-Mir-204-P1_3p*

MirBase accessionMIMAT0021854
Sequence
39- GCUGGGAAGGCAAAGGGACGU -60
Get sequence