MirGeneDB

MirGeneDB ID

Aca-Mir-204-P2

Family name MIR-204 (all species)
Seed UCCCUUU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-204a-1
Paralogues Aca-Mir-204-P1 
Orthologues Ami-Mir-204-P2  Bta-Mir-204-P2  Cfa-Mir-204-P2  Cli-Mir-204-P2  Cpi-Mir-204-P2  Cpo-Mir-204-P2  Dno-Mir-204-P2  Dre-Mir-204-P2a  Dre-Mir-204-P2b  Gga-Mir-204-P2  Hsa-Mir-204-P2  Mdo-Mir-204-P2  Mml-Mir-204-P2  Mmu-Mir-204-P2  Oan-Mir-204-P2  Ocu-Mir-204-P2  Rno-Mir-204-P2  Sha-Mir-204-P2  Sto-Mir-204-P2  Tgu-Mir-204-P2  Xtr-Mir-204-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343428.1: 107556-107613 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGGCUGCCUGGAUCACAUGACCUGUGGGCUUCCCUUUGUCAUCCUAUGCCUGGAGAUCGCAGAGAGGCAGGGACAGCAAAGGGGUGCUCAGCUGUUGUCUCUAACGUCGGUCAGCCA
Get precursor sequence
Structure
        10          20        30        40        50         
GAGGCUGCCUGGAUCAC--|UG  CUG     U         CA    A     GGAGAU 
                   A  AC   UGGGC UCCCUUUGU  UCCU UGCCU      \
                   U  UG   ACUCG GGGGAAACG  AGGG ACGGA      C
ACCGACUGGCUGCAAUCUC^GU  UCG     U         AC    -     GAGACG 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-204-P2_5p

MirBase accessionMIMAT0021853
Sequence
0- UUCCCUUUGUCAUCCUAUGCCU -22
Get sequence
Star sequence

Aca-Mir-204-P2_3p*

MirBase accessionNone
Sequence
37- GCAGGGACAGCAAAGGGGUGC -58
Get sequence