MirGeneDB

MirGeneDB ID

Cli-Mir-204-P2

Family name MIR-204 (all species)
Seed UCCCUUU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-204-2
Paralogues Cli-Mir-204-P1  Cli-Mir-204-P3 
Orthologues Aca-Mir-204-P2  Ami-Mir-204-P2  Bta-Mir-204-P2  Cfa-Mir-204-P2  Cpi-Mir-204-P2  Cpo-Mir-204-P2  Dno-Mir-204-P2  Dre-Mir-204-P2a  Dre-Mir-204-P2b  Gga-Mir-204-P2  Hsa-Mir-204-P2  Mdo-Mir-204-P2  Mml-Mir-204-P2  Mmu-Mir-204-P2  Oan-Mir-204-P2  Ocu-Mir-204-P2  Rno-Mir-204-P2  Sha-Mir-204-P2  Sto-Mir-204-P2  Tgu-Mir-204-P2  Xtr-Mir-204-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold506: 653116-653173 [+]
Precursor
(pre-Mir +30nt flank)
AAGGCUACUGAGACCAUGUGACCUGUGGGCUUCCCUUUGUCAUCCUAUGCCUGGAGAUCACAGUGAGGCAGGGACAGCAAAGGGAUGCUCAGCUGUCGUCUCUUCCAUCGGCCAGCCA
Get precursor sequence
Structure
        10          20        30        40        50         
AAGGCUACUGAGACCAUG--|   CUG     U         CA    A     GGAGAU 
                    UGAC   UGGGC UCCCUUUGU  UCCU UGCCU      \
                    GCUG   ACUCG AGGGAAACG  AGGG ACGGA      C
ACCGACCGGCUACCUUCUCU^   UCG     U         AC    -     GUGACA 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-204-P2_5p

MirBase accessionMIMAT0038580
Sequence
0- UUCCCUUUGUCAUCCUAUGCCU -22
Get sequence
Star sequence

Cli-Mir-204-P2_3p*

MirBase accessionMIMAT0038582
Sequence
37- GCAGGGACAGCAAAGGGAUGC -58
Get sequence