MirGeneDB

MirGeneDB ID

Sto-Mir-204-P2

Family name MIR-204 (all species)
Seed UCCCUUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-204-P1  Sto-Mir-204-P3 
Orthologues Aca-Mir-204-P2  Ami-Mir-204-P2  Bta-Mir-204-P2  Cfa-Mir-204-P2  Cli-Mir-204-P2  Cpi-Mir-204-P2  Cpo-Mir-204-P2  Dno-Mir-204-P2  Dre-Mir-204-P2a  Dre-Mir-204-P2b  Gga-Mir-204-P2  Hsa-Mir-204-P2  Mdo-Mir-204-P2  Mml-Mir-204-P2  Mmu-Mir-204-P2  Oan-Mir-204-P2  Ocu-Mir-204-P2  Rno-Mir-204-P2  Sha-Mir-204-P2  Tgu-Mir-204-P2  Xtr-Mir-204-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01322934.1: 406-463 [+]
Precursor
(pre-Mir +30nt flank)
CACGUCAGAGAGACGCUGUGACCAGUGGGUUUCCCUUUCUCAUCCUAUGCCUGGGAAUAUUGAUAAGGCAGGGAGGAUAAAGGAUCACUCAACUGUCGAAUUCACUCCCUCCUCACCU
Get precursor sequence
Structure
        10          20         30        40        50         
CACGUCAGAGAGACGCUG--|   C   -    UUC     C  A    A     GGGAAU 
                    UGAC AGU GGGU   CCUUU UC UCCU UGCCU      \
                    GCUG UCA CUCA   GGAAA AG AGGG ACGGA      A
UCCACUCCUCCCUCACUUAA^   -   A    CUA     U  G    -     AUAGUU 
      110       100         90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-204-P2_5p

MirBase accessionNone
Sequence
0- UUCCCUUUCUCAUCCUAUGCCU -22
Get sequence
Star sequence

Sto-Mir-204-P2_3p* (predicted)

MirBase accessionNone
Sequence
37- GCAGGGAGGAUAAAGGAUCAC -58
Get sequence