MirGeneDB

MirGeneDB ID

Rno-Mir-425

Family name MIR-425 (all species)
Seed AUGACAC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-425
Paralogues
Orthologues Aca-Mir-425  Ami-Mir-425  Bta-Mir-425  Cfa-Mir-425  Cli-Mir-425  Cpi-Mir-425  Cpo-Mir-425  Dno-Mir-425  Dre-Mir-425  Ete-Mir-425  Hsa-Mir-425  Mdo-Mir-425  Mml-Mir-425  Mmu-Mir-425  Oan-Mir-425  Ocu-Mir-425  Sha-Mir-425  Sto-Mir-425  Tgu-Mir-425  Xtr-Mir-425 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(rn6)
chr8: 117354831-117354893 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-425)
Mir-191 chr8: 117354378-117354441 [+] UCSC Ensembl
Mir-425 chr8: 117354831-117354893 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACUGAACCCACAGCAUGGAAAGUGCUUUGGAAUGACACGAUCACUCCCGUUGAGUGGGCACCCAAGAAGCCAUCGGGAAUAUCGUGUCCGCCCAGUGCUCUUUCGGCACCUCCCAAACAGGGC
Get precursor sequence
Structure
        10          20        30        40        50        60 
ACUGAACCCACAGCAUG--|    U  U    AAU        CAC     U  AGUGGGCA 
                   GAAAG GC UUGG   GACACGAU   UCCCG UG        C
                   CUUUC CG GACC   CUGUGCUA   AGGGC AC        C
CGGGACAAACCCUCCACGG^    U  U    CGC        UA-     U  CGAAGAAC 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentThere are multiple Dicer sites +1 and +2 relative to what is annotated here. There is a minor Drosha site +1 as well.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-425_5p

MirBase accessionMIMAT0005314
Sequence
0- AAUGACACGAUCACUCCCGUUG -22
Get sequence
Validated targets microrna.org: MIMAT0005314
TargetScanVert: rno-miR-425-5p
miRDB: MIMAT0005314
Star sequence

Rno-Mir-425_3p*

MirBase accessionMIMAT0017306
Sequence
42- UCGGGAAUAUCGUGUCCGCCC -63
Get sequence
Validated targets TargetScanVert: rno-miR-425-3p
miRDB: MIMAT0017306