MirGeneDB

MirGeneDB ID

Aca-Mir-425

Family name MIR-425 (all species)
Seed AUGACAC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-425
Paralogues
Orthologues Ami-Mir-425  Bta-Mir-425  Cfa-Mir-425  Cli-Mir-425  Cpi-Mir-425  Cpo-Mir-425  Dno-Mir-425  Dre-Mir-425  Ete-Mir-425  Hsa-Mir-425  Mdo-Mir-425  Mml-Mir-425  Mmu-Mir-425  Oan-Mir-425  Ocu-Mir-425  Rno-Mir-425  Sha-Mir-425  Sto-Mir-425  Tgu-Mir-425  Xtr-Mir-425 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(anoCar2)
2: 187863035-187863096 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-425)
Mir-2970 2: 187861425-187861483 [-] UCSC Ensembl
Mir-425 2: 187863035-187863096 [-] UCSC Ensembl
Mir-191 2: 187865108-187865171 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGAAGACACAAGAGCAGGAAUGGUUUUGGAAUGACACGAUCACUCCCGCUGAGCGAGCAGAGCCACGGCCACGGGGAUGUCGUGUCUGUCCAAAACUAUUUCAAAUAACCCAGCCUGGCUC
Get precursor sequence
Structure
        10          20        30        40        50        60  
AGGAAGACACAAGAGCA--|             AU       U  CU    C  A  GAGCAG 
                   GGAAUGGUUUUGGA  GACACGA CA  CCCG UG GC      \
                   CUUUAUCAAAACCU  CUGUGCU GU  GGGC AC CG      A
CUCGGUCCGACCCAAUAAA^             GU       -  AG    -  -  GCACCG 
120       110       100        90         80          70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 relative to what is annotated here.
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-425_5p

MirBase accessionMIMAT0021954
Sequence
0- AAUGACACGAUCACUCCCGCUGAGC -25
Get sequence
Star sequence

Aca-Mir-425_3p*

MirBase accessionMIMAT0021955
Sequence
39- CCACGGGGAUGUCGUGUCUGUCC -62
Get sequence