MirGeneDB

MirGeneDB ID

Aca-Mir-2970

Family name MIR-2970 (all species)
Seed ACAGUCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-2970
Paralogues
Orthologues Ami-Mir-2970  Cli-Mir-2970  Cpi-Mir-2970  Mdo-Mir-2970  Oan-Mir-2970  Sha-Mir-2970  Tgu-Mir-2970  Xtr-Mir-2970 
Node of Origin (locus) Sarcopterygii
Node of Origin (family) Sarcopterygii
Genome context
(anoCar2)
2: 187861425-187861483 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-2970)
Mir-2970 2: 187861425-187861483 [-] UCSC Ensembl
Mir-425 2: 187863035-187863096 [-] UCSC Ensembl
Mir-191 2: 187865108-187865171 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUACCUAUAUACUUGAGAUCUGUCACUGCAGACAGUCAGUAGUUGGUCUGGCAUAAGCAGAAAGUUUCAGAUCACCUCUUGGCUGUGAGUAGUGUGGAGCCCUGCCCUAUUUUACUAUG
Get precursor sequence
Structure
        10           20        30        40        50         
AUACCUAUAUACUUGAGA---|   U      AG        U  U        CAUAAGC 
                     UCUG CACUGC  ACAGUCAG AG UGGUCUGG       \
                     AGGU GUGAUG  UGUCGGUU UC ACUAGACU       A
GUAUCAUUUUAUCCCGUCCCG^   -      AG        C  C        UUGAAAG 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-2970_5p

MirBase accessionMIMAT0021909
Sequence
0- GACAGUCAGUAGUUGGUCUGGC -22
Get sequence
Star sequence

Aca-Mir-2970_3p*

MirBase accessionMIMAT0021910
Sequence
37- CAGAUCACCUCUUGGCUGUGAG -59
Get sequence