MirGeneDB

MirGeneDB ID

Aca-Mir-191

Family name MIR-191 (all species)
Seed AACGGAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-191
Paralogues
Orthologues Ami-Mir-191  Bta-Mir-191  Cfa-Mir-191  Cpi-Mir-191  Cpo-Mir-191  Dno-Mir-191  Dre-Mir-191  Ete-Mir-191  Hsa-Mir-191  Mdo-Mir-191  Mml-Mir-191  Mmu-Mir-191  Oan-Mir-191  Ocu-Mir-191  Rno-Mir-191  Sha-Mir-191  Sto-Mir-191  Xtr-Mir-191 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(anoCar2)
2: 187865108-187865171 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-191)
Mir-2970 2: 187861425-187861483 [-] UCSC Ensembl
Mir-425 2: 187863035-187863096 [-] UCSC Ensembl
Mir-191 2: 187865108-187865171 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUCACCUUCCAAUGAUGGUUUGAUAGUGGGCAACGGAAUCCCAAAAGCAGCUGUUUUCCUCUUAAAGUUCCAGCUGCACUUGGAUUUCGUUCCUUGCUUUCCUACCCUUCUCUCCUGGAUUGUG
Get precursor sequence
Structure
        10          20        30        40        50        60  
AUCACCUUCCAAUGAUG--| UU  U  UG  C          C  AA       UUUUCCUC 
                   GU  GA AG  GG AACGGAAUCC AA  GCAGCUG        \
                   CA  CU UC  UC UUGCUUUAGG UU  CGUCGAC        U
GUGUUAGGUCCUCUCUUCC^ UC  U  GU  C          -  CA       CUUGAAAU 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-191_5p

MirBase accessionMIMAT0021824
Sequence
0- CAACGGAAUCCCAAAAGCAGCUG -23
Get sequence
Star sequence

Aca-Mir-191_3p*

MirBase accessionMIMAT0021825
Sequence
42- GCUGCACUUGGAUUUCGUUCCU -64
Get sequence