MirGeneDB

MirGeneDB ID

Rno-Mir-191

Family name MIR-191 (all species)
Seed AACGGAA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-191a
Paralogues
Orthologues Aca-Mir-191  Ami-Mir-191  Bta-Mir-191  Cfa-Mir-191  Cpi-Mir-191  Cpo-Mir-191  Dno-Mir-191  Dre-Mir-191  Ete-Mir-191  Hsa-Mir-191  Mdo-Mir-191  Mml-Mir-191  Mmu-Mir-191  Oan-Mir-191  Ocu-Mir-191  Sha-Mir-191  Sto-Mir-191  Xtr-Mir-191 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(rn6)
chr8: 117354378-117354441 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-191)
Mir-191 chr8: 117354378-117354441 [+] UCSC Ensembl
Mir-425 chr8: 117354831-117354893 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAGCCCUCCUCCAAUGGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCACUUGGAUUUCGUUCCCUGCUCUCCUGCCUGAGCAGCGCCCUGGCCC
Get precursor sequence
Structure
        10          20        30        40        50        60  
AGAGCCCUCCUCCAAUG--| U   C      C          C  AA       UUGUCUCC 
                   GC GGA AGCGGG AACGGAAUCC AA  GCAGCUG        \
                   CG CCU UCGUCC UUGCUUUAGG UU  CGUCGAC        A
CCCGGUCCCGCGACGAGUC^ U   C      C          -  CA       CUUACGAG 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-191_5p

MirBase accessionMIMAT0000866
Sequence
0- CAACGGAAUCCCAAAAGCAGCUG -23
Get sequence
Validated targets microrna.org: MIMAT0000866
TargetScanVert: rno-miR-191a-5p
miRDB: MIMAT0000866
Star sequence

Rno-Mir-191_3p*

MirBase accessionMIMAT0017146
Sequence
42- GCUGCACUUGGAUUUCGUUCCC -64
Get sequence
Validated targets TargetScanVert: rno-miR-191a-3p
miRDB: MIMAT0017146