MirGeneDB

MirGeneDB ID

Sto-Mir-191

Family name MIR-191 (all species)
Seed AACGGAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Aca-Mir-191  Ami-Mir-191  Bta-Mir-191  Cfa-Mir-191  Cpi-Mir-191  Cpo-Mir-191  Dno-Mir-191  Dre-Mir-191  Ete-Mir-191  Hsa-Mir-191  Mdo-Mir-191  Mml-Mir-191  Mmu-Mir-191  Oan-Mir-191  Ocu-Mir-191  Rno-Mir-191  Sha-Mir-191  Xtr-Mir-191 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(miRNA_loci_genome)
BFAA01003406.1: 116588-116647 [+]
Precursor
(pre-Mir +30nt flank)
UGUUACCCUGACACUGUGUAUGAGUAGCACAAACGGAACCCCAAAAGUAGCUGUGAGCCUAGAAAUCGGCUGCUGUUGGGUUCUGUUACUGCUAGUCGUGGACUCACUGCUGGAAUGUCU
Get precursor sequence
Structure
        10          20        30        40        50          
UGUUACCCUGACACUGUG--|    G     CA          CAAA        UGAGCC 
                    UAUGA UAGCA  AACGGAACCC    AGUAGCUG      \
                    GUGCU AUCGU  UUGUCUUGGG    UCGUCGGC      U
UCUGUAAGGUCGUCACUCAG^    G     CA          UUG-        UAAAGA 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-191_5p

MirBase accessionNone
Sequence
0- AAACGGAACCCCAAAAGUAGCUG -23
Get sequence
Star sequence

Sto-Mir-191_3p*

MirBase accessionNone
Sequence
38- GCUGCUGUUGGGUUCUGUUACU -60
Get sequence