MirGeneDB

MirGeneDB ID

Cpi-Mir-214-v1

Family name MIR-214 (all species)
Seed CAGCAGG
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-214
Paralogues Cpi-Mir-214-v2 
Orthologues Aca-Mir-214-v1  Ami-Mir-214-v1  Bta-Mir-214-v1  Cfa-Mir-214-v1  Cli-Mir-214-v1  Cpo-Mir-214-v1  Dno-Mir-214-v1  Dre-Mir-214-v1  Ete-Mir-214-v1  Gga-Mir-214-v1  Hsa-Mir-214-v1  Mdo-Mir-214-v1  Mml-Mir-214-v1  Mmu-Mir-214-v1  Oan-Mir-214-v1  Ocu-Mir-214-v1  Rno-Mir-214-v1  Sha-Mir-214-v1  Sto-Mir-214-v1  Tgu-Mir-214-v1  Xtr-Mir-214-v1 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(chrPic1)
JH585174: 220443-220505 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-214-v1)
Mir-214-v1 JH585174: 220443-220505 [-] UCSC
Mir-214-v2 JH585174: 220443-220505 [-] UCSC
Mir-199-P3-v1 JH585174: 227135-227195 [-] UCSC
Mir-199-P3-v2 JH585174: 227135-227195 [-] UCSC
Mir-199-P3-v3 JH585174: 227135-227195 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GGGACUGGCUGGACGGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCUCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCUGAAUGACAACCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGGACUGGCUGGACGGA--|          U          ACA          AGAACAUC 
                   GUUGUCAUGUG CUGCCUGUCU   CUUGCUGUGC        \
                   CAACAGUACAC GACGGACAGA   GGACGACAUG        C
ACCAACAGUAAGUCCGACC^          U          CAC          UCCACUCU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Te Te Te To
Star sequence

Cpi-Mir-214-v1_5p*

MirBase accessionMIMAT0037839
Sequence
0- UGCCUGUCUACACUUGCUGUGC -22
Get sequence
Mature sequence

Cpi-Mir-214-v1_3p

MirBase accessionMIMAT0037840
Sequence
41- ACAGCAGGCACAGACAGGCAGU -63
Get sequence