MirGeneDB

MirGeneDB ID

Sha-Mir-214-v1

Family name MIR-214 (all species)
Seed CAGCAGG
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID
Paralogues Sha-Mir-214-v2 
Orthologues Aca-Mir-214-v1  Ami-Mir-214-v1  Bta-Mir-214-v1  Cfa-Mir-214-v1  Cli-Mir-214-v1  Cpi-Mir-214-v1  Cpo-Mir-214-v1  Dno-Mir-214-v1  Dre-Mir-214-v1  Ete-Mir-214-v1  Gga-Mir-214-v1  Hsa-Mir-214-v1  Mdo-Mir-214-v1  Mml-Mir-214-v1  Mmu-Mir-214-v1  Oan-Mir-214-v1  Ocu-Mir-214-v1  Rno-Mir-214-v1  Sto-Mir-214-v1  Tgu-Mir-214-v1  Xtr-Mir-214-v1 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(DEVIL7_traces)
GL856751.1: 2989385-2989447 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGACUGGCUGGACGGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCUCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCUGAAUGACAACCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGGACUGGCUGGACGGA--|          U          ACA          AGAACAUC 
                   GUUGUCAUGUG CUGCCUGUCU   CUUGCUGUGC        \
                   CAACAGUACAC GACGGACAGA   GGACGACAUG        C
ACCAACAGUAAGUCCGACC^          U          CAC          UCCACUCU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Star sequence

Sha-Mir-214-v1_5p*

MirBase accessionNone
Sequence
0- UGCCUGUCUACACUUGCUGUGC -22
Get sequence
Mature sequence

Sha-Mir-214-v1_3p

MirBase accessionNone
Sequence
41- ACAGCAGGCACAGACAGGCAGU -63
Get sequence